Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18477  (registered. 2003)
Contig Information
Length 1123 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1071
Evalue 1.11873e-114
Total Hit Count 173
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18477
TTTTTTTTTTCCAAACAGAATGACAAACTTGGATTACCCAAAGCAGCTCATACATTAAGAAACATTCATCCTTTTCTACCAGTGTTGCCAGAGTACATAG
GTGAAAAAGATAGCTCGCGGCTTCGTAATTAGTAGCGCTCGTAAATAATATCAATAATAATACAATTACAACGTATAACTGTCTGATCAGACGACAAGCT
AAAAACAAAACTTGCAGGGCCTAGTGGTGCTTGTTCAGATCAATTCTTCAGTAGTTTCCTCAACACGTCTTCAGCATGACGCTCCATCTTTGGTAAAGCC
CAGTCATGCTGGATGATGTCGAGGCTGTCTTTCTCTGCGCTCAAGCTCATTGCTGGATTAAAGCCCATTCCACCACCCATCGCCATCATCTTTTGGGCAT
CATCAGTAGCTGCATAAACATTTTCTTCACCAAGGATGAGACTGAAAAGACCCCTCAAGCCAAATAAATTGAGGAAGTACCATGAACGGCTGCTAACATA
GCTCACATCAACAGTACTCAGGTCTATCCCATTTTGCAGCATTCCCCTGAATCGTTGAGTCAATGGAAAGGGGATTTTGGCTGCAACAAAACCGGAAAAG
AAGAAGTTCACCCATGCAAATGTAAGTGTCTGTGGAACTATCATGGAGAGATTCTTCTTCATCATATCCATGGCCATGTTTGGGTCCGAAAACATAGCCG
CCTGAGCCTTCTGGGCATCCTCTTTAGGAACATGAAGCAATCCTGCTTCCCCGTTGGTGTAATAAAGCTTGCGAGCCTTGAAGGCCTTGGCCGGGATGAA
CTGCGCGCCGTTCCTCAGGTTCCTCGCCCTGATGACGACCTGCCCCTCCTTGACGGTCTTGGGGTCGGGGGAGGGCGAGGCCGACGGCGGGGAGCGCATG
AGCTTGGACACGAAGTAGCGGAGCACGCCGATGAGCACCATGACCACGGAGAGCGGGATGAGGACCCAGTCCCGGATCGCCGTGTCCAGCACCAGCTCCT
CAGCCATCGGGGCCGGGCGGGGTGACTGGCTACGTCCTACCTGGGGCGGCGAGCCGGCGACCGGCGACGCGGCGGTGGCGTCGCGAGGGGGAGGAGACGG
GACGAGAGGGGAGAGCTCGTCGT
page-top