Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18384  (registered. 2003)
Contig Information
Length 538 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 216
Evalue 3.64368e-16
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18384
TTTTTTTTTTAATACTACTAATCACGAGAAGCTTTATTCTGGTTCACGATTAGCGCTTATTTAAGCGCTGCACGGGCGCGCGATAGGGGCTGATGGCCGC
CAAGCACGCACGCCTGCATACGCTATACGACTGTGCGCAACATCACACATACATATACTGCTGACATGCATACATATACACACATCGTAGTGTGCTCCGT
TACGTGTAAGCTCAGTCATCGGCCCTGACGACGAAGTTCTCCTTGCGCTCGTGGAACTCCCCGGTGCGGGTGTTGAAGTCCTCCTCGAGCCTGCTCTCGC
GCACCTCGAAGTGACCAGAGCCGCGGCCGTGGTGACCGTGGTGACCGTGGCGGCGGCCGGAGGTGTCGAACTCCTGCACGAACGTCTCCTTGACGATGTG
CTCCTGCACGCCGCCGCCGCGGCGGGCCGGGTTGCCCACCGCCCTCACCTCCTCCGAGCAGTAGTCCACCTCCTGGAAGTGCGCCATGCCGATCGGTCGA
TGTTACTATGTGCTTGGTTGGGTTTGTGTGTGTTGGTG
page-top