Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7180  (registered. 2012)
Contig Information
Length 1087 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 10
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242047496|ref|XP_002461494.1|| hypothetical protein SORBIDRAFT_02g003510 [Sorghum bicolor]
Score 333
Evalue 2.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7180
TTTGAGCCTCGTGGGCATATATATAGGAGTNNNTGATCTACTTGGAATACAAGACAAGCCAGAACAAATTCTAGTCTGTCTCGTCTTTCCTAATAATCAA
TATACTCAACAGGTAGTTGATGTATGGAGTGAGATGAGATTAGGGGTCGACAGACACAAAGGCTTAGAATGGTCGCCGATGTTAGATAAATATGAGACTA
CTTGTGAATAGACAATCCGGTTGGCAACCAATTAGCTGGCACGCTACAAGATATAGGGCACCAGAGCCTTGATGCTCGTCGGGAATTCCTCGAACTTGGA
TTCGTACCATCTCCGGGTGGCGAAGCTTCGGCCGACGAGGTAGGCTGCCGTGCCGAAGGCCATGGCGAGCGCATAAACCGTCTGTGAGATCATCGCGAAC
CCGAAGAATCCGGTGATCTCGAAGAGGTAGTGCGGGCAGGTGACGAACTCGAAGAGCCCGCCTTTGGGGATCTTGTACCCCGTATCGTCGTCACCTCCCT
TCCTGAGTTGCGAGAGGAGGTCCGTTGTAGGGTCAGGTAGTCCGACGGCGAGGTGCTGCGCGTAGATCATGGTGATGGCGCTGAGCAGGTAGCTGGAGGA
GATGGCGAGCGCCGTGTTGAGTGGCATGTTCCCACTATACCGATGGATGAAGAGTACCTCGAGGACACGCTTGAGGAAGTGGACGGCGAGGAGCTCGGCG
CGCAGCCCTTCCACGGTACCCGGCACGACGAAGGACGCCGCGGCGGCGACTAGCGCCGGCGCGTAGGCCACCAGCATCCCGTCACGGCCCGACAGCTGCA
CGCCACCGGTGCCTCCCTTCTTCTGCTGCTGTCCAGACACGACGTGCCAGAACTTGGAGTAGGCCATGTGTTGGCTGCGGAGCTCAGAGAGGCCCGCGGA
CGCCAGCGACGCGAACGACACCACAGACATCGCCGTCACGAAGGCCGACGCCGGCGGCGGGTACAGCAGCGACGACTGCCACATCTCTCTCTCGACCGTC
CACTTGGCCTTGGTGTAGGAGCTAGCCCTGGATCGACCCTTGCGTTGCGCATCTCCTTGGTACTCAGGCCGTTGGTTTATGCTCAGG
page-top