Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7179  (registered. 2012)
Contig Information
Length 904 bp
Clones alternative view 65 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226492497|ref|NP_001146962.1|| hypothetical protein LOC100280571 [Zea mays]
Score 309
Evalue 2.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7179
ATATAGCCCTGCTGCTCCTGGCCCCTTTCCCCAGTTCCATCCCATTATTGGTTCTTGCGAGGAGGGGGGCGGAGAAGCGGAAGCAGGAGGCAGAGAGGAG
ATCAGGCCAGAGGAGGGCGAGGGAGGGCGCGATGGCGTCCAAGAGGATACAGAAGGAGCTCAAGGATCTGCAGAAGGATCCCCCCACCTCATGCAGCGCA
GGCCCTGTGGGTGAAGATATGTTCCATTGGCAGGCAACAATAATGGGCCCATCTGACAGCCCATATTCCGGTGGAGTTTTCCTAGTTACTATCCACTTCC
CTCCTGATTATCCTTTCAAACCACCAAAGGTGGCATTCCGCACCAAGGTGTTCCATCCAAACATCAACAGCAACGGGAGCATTTGTCTGGACATCCTCAA
GGACCAATGGAGCCCCGCTCTGACCATTTCCAAGGTGCTGCTGTCCATCTGCTCCCTGCTGTGTGACCCAAACCCTGACGATCCTCTGGTTCCTGAGATC
GCTCACATGTACAAGACGGACCGGCACAAGTATGAGAGCACCGCCAGGACCTGGACGCAAAGGTATGCCATGTAATGTAAGACGGCGCACGGATCGCTGG
AGTCAGTCTTGTTTGTAATATTCTCGATCTGTTCGTGTGCCCGCCCGGTGTATGTGTCTGTCAAACTGGCACTCGTTGCTCAACTGTGTCACTTGGCGCA
GTGACTTGGAACATGGAACCGGTGTTGCATATTTTGGATTCAGATAAATGTCGCCACCTGCCGCCAGGTCGGTGCTTGCGTCAGGCTTTAAATTAAAAAC
CTGTTTGCGGGACACCCGTACCAGTACTGGTCTGATCATGTGCAGGGGTCTCTCAGGTGGCGTCAAAATAATCGATTAGGGAGTAGTACACTAATGATAA
CGCC
page-top