Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18343  (registered. 2003)
Contig Information
Length 860 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit C-8,7-sterol isomerase [Hordeum vulgare]
Score 1089
Evalue 5.99326e-117
Total Hit Count 170
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18343
TTTTTTTTTTGTAGTACTGCATACTTTGTTTCAGACAATGTAGTTTACAAAGGGTACAATACAAGGAAGCAAATTGTGGTAAAACAAGAATTTCAGTGTG
TCCTGGTTGCAACCAACCCTCTGTGTTGCTGGAATTACTTGGTCTTGACCTTCTCGCTTTGATGAACCGCCGCGCAGATCTTCTTCCAGCTCCTTGTGGC
GATCAGCAACGGTATCACAATCCACAAACTGTTTGCGCCGATGAAATATGCCCAGAAGTAGAACGGGCTGGCCCAGAAGTTGAAGCCGTCCAAGTAGGCG
GTGGTGAAGTAGACGATGCATCCGTAGAGCTGACCGAGGCACACGGCAAACTGGAGGATGTGGCTGTAGGACTTTCGCGACGCGATAGCATAGACTGCGA
GCAGCGAGGCAGGGCCTTTCAGCACGGCCGTGATTCCCTCGACGGTGACGGTGGCGGTGTCCCTGGCGACGTACCTGGAGTCACCCTTGCTGTACTCCTT
CCAGACTTCGTCGAAGAAGTTGGGGTTGGTCTTGGTGAAGAAATCGGGGGTAAAGACGAAGGGCCCCTCGATGAGTATGTGGGTGAGGCCGGTGAACGCC
CACCAGCACATGAGCAGGCGGTCGGTCCCGGACAACCTGCGGCATCTCCCGGAGAGGAGCCAGACGGCGACGAGGACGAAGAGGGAGGTGCCGAGGTAGG
CCCCGAGGATCTCGAGCTGGGTGAGGCGCAGCGGCACGTAGCCCGGGAGGTCCAGGCCCGCCGGCACGTAAGGGTGCGCGCCCATCGCCGCCGCCGCCGC
CGTCTCGATCTGGGAGCCGGAGCTGGAGCTGGAGGAAATCTGCACTAGTCAACTCGACTG
page-top