Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18341  (registered. 2003)
Contig Information
Length 972 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 5
Homology (BLAST) Top Hit polyamine oxidase [Hordeum vulgare subsp. vulgare] >gi|14488153|emb|CAC42119.1| flavin containing polyamine oxidase [Hordeum vulgare subsp. vulgare]
Score 905
Evalue 1.83062e-144
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18341
ACAGTAGCGTCCATCGTTGGACGAAACTAATCAAACGAGGGGAGAAGAGAGAGAGACAGATCGCGATGAAGTCTTGGTTCGTCACTGCTATAGCGGCACT
AGTGCTGATAGCCGCACAGCATGCCTCCCTCGTCGCCGCCGGCAGAGGCCCCAGGGTCATCATAGTCGGCGCCGGCATGTCCGGGATCTCGGCGGGGAAG
CGGCTGTGGGACGCCGGGGTGAGGGACCTGCTGATCCTGGAGGCGACGGGCCGCGTGGGCGGGCGAATGCACAAGCACAACTTTGGCGGGCTCAACGTGG
AGATCGGCGCCAACTGGGTGGAGGGCCTCAACGGGGACAAGGTGAACCCCATCTGGCCCATGGTCAACGCCAGCCTCAAGCTCCGCAACTTCTACTCCGA
CTTCGACGGCGTCGTCGGCAACGTCTACAAGGAGAGTGGTGGGCTTTACGACGAGGAGTTCGTGCAGAAGAGAATGGACCGCGGCGACGAGGTGGAGGAG
CTGGGCGGCAAGCTCGCCGCGGAGATGGATCCCAGCGGCCGCGACGACATCTCCATCTTGGCCATGCAGCGCCTCTTCAACCACCAGCCGAACGGGCCGG
CGACGCCGGTGGACATGGTGCTCGACTACTTCAGGTACGACTACGAGTTCGCCGAGCCGCCCGCGCGTCACCAGCCTGCAGGGCACCGAGCCGACGGCCA
CCTTCGCCGACTTCGGGGATGACGCCAACTTTGTCGCCGATCAGCGGGGATTCGAGACCCTCATATATCACATCGCCGGCCAGTACCTGCGTTCCGACAA
GTCCGGGAACATCGTAGATCCTAGGGTCAAGCTCAACAAGGTGGTGCGTGAGATCTCCTACGACCAGAGAGGCGTGGTGGTGACTACGGAGGACAACTCA
GCGTACAGCGCAGACTACGTGATCGTGTCCGCCAGCATAGGGGTCCTGCAAAGCGACCTCATACAGTTCAAG
page-top