Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18266  (registered. 2003)
Contig Information
Length 678 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 3
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit syntaxin 32 [Zea mays]
Score 518
Evalue 6.20299e-51
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18266
TTTTTTTTTTATAAAACATACTGTAATAAAAATATAATACTACCGCCCGGTCGGTAGTAACAACAGATCCATCCTGGATGCTTCCCCCAATTTACATGAC
CACGGAGGCTACTAGACTGCCTGCCGCTTATCATCATCATCCCAGTGAAAATTGTGTACATGGTGTATGTAGTTCGGTAAAAATTAAAGAATATACTTGC
ACACAACATGCGTTACAAGGGGTGGGGATCATGCCACGAAGAATATGAAGATCATGAGGAACACCATCAGCACGAAGAATATCTTCATCATCAGCCACCT
GTTTGACGAGATGCTGTTGAGGTACTTCAAGAGTTGGCCCTGCGCTCCCTCGACGTTGGCTACCGTCTCCTCCATGTTCTCATCGATTCTGATTGCTAAC
TCTCCCTGCTGAGACACCATGGTTGCCAGCTGGGTAAAAATGTTGCTCAGCTCATGGATGGTTGATTCCACATTTTGAAGAGCCTCAGCTCTGCTCTGCA
TGTAACTATCCTGCTGTACTGCCAATTGCTGCTGCTGCATGAAAGCAGGAGACGACGACGACGATGATGATGCTCCATGATCTCCATTAGTCTTCTTCCT
CTGAAACAACGGCGTAGTTGCAGAGTCACTGGCCCATGGCGCTGGGGGTGCAGCGTCGGATGCCTCTCTGGGAACAAG
page-top