Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18255  (registered. 2003)
Contig Information
Length 1489 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit hypothetical protein OsI_19436 [Oryza sativa Indica Group]
Score 1603
Evalue 3.39954e-176
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18255
GGGGAACAAATGGTGGATACTTTGATTCAGTAATGAGCCCCTCTCCCCCTAAAAGAGAGCACAACTCATTATTATTGTTGATAACCATATGTGAACCATT
TTCTACGCACTGAACAATCGGTACAGCCGCGCTGGTACGTGACCCATAAGTCCAAAAATGTACATACAGTATCTGTACTGTAACAACAGACAACGTACCA
CATCATTACGGCTGCACACCAGTAAACCGAACTGCCTCTCTACAGTTGTAAACACACAGGTTTTGATACCATGAACATTGGACACCAAAAGAAGGTGGCA
CACACATGGCATAAAATGCAACTAATTCCCCAACCATTCGAAGCAACAGCAGAGGCCCCAGCAAAACCTCGAAGGGTAGTTCCGCACGAAAACATCCCTG
CCGTAGCCAACGACGTAGAAGCTAAAAGATCGCTTACGGTGCGACATAGTGACATGGGTTACGGGCACGACCGAGATGATGTGTCTCTCCGAAATGACAA
TTGCGGATGGTGGAACTGGCAGCCGGCTAGCAACAACCTCCGAGGACAACTGGTTGAGTGGGTATGAATCGGCAAAGAAAGCAGGAGTGCATTGGTATGC
CTGTATGTTGCATAGTTGCGCCCCTTGCGCTCTGTGGAAAACTTCGTCAGGGACCGCAGCAGTTTCTGCTGTTGCACTAACTTTTCTCGCTGTAAGCGTC
TCCCATCGAACGCGAGCAATGCTTTGTGTAAGAAGGGAACCGCAGCCATTACATGTCCGGCATGTTACTATGCCACGGGATCCACATTCTGTGCAGGGCA
ACACTCCTTGACCATTGCACATCCAACATACTGAATCAGATTCATCTTGCTGAGCGAGTGAACCCCTGCCCTGACATACACTGCACTGAGTCATTTGATT
TGCCATGTAAAACCCGTACTGCCGACCAGGATTGCAAGTAGGACATGGAACCTTTCCACGACCCTCGCAATCTGAGCACTTCTCAGTAACTTGTGAATGA
GGAATCTTGACCCTTACTTCTTTCTCCGGTACAAAGAGCGGAGGAAACTCGGACCTCAAATCTAGTTCCCACACCCCAAGGACAGGGCCCTTGTCTCTCC
CATCTACTTCCCCACCATGATAGGGTTCCCTTTCTAATATGGCGTCTCTTTGCTCGATGAAGGTTTCCAAGGTTCCAACATATACATCGCAGCAGTCCTT
GATGGATGTAATCTTCCATGTCCGAGCAGGCCGGCTGCCCCAACAACATCGATGCCCAACATGTTCGATTAGCATCTGCCGAACCTCCACCTCATCCAGT
ACATCCCTCCTGGCGCCCTGCGAAGGCTGGTAATCACCGCCGTACGGGTACGGCCCTTGAGGAACAATCGCCAAACCATGCGAATGCGGAGGAGTGGCAG
CAGTTGCCGGGGATGGGGAGAGGACGGCGCTGTGGATGGACGGTGGGTAGACGGCGTCGTGGTGAGGATTGGGCGCCGGGGGATAGTAG
page-top