Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18250  (registered. 2003)
Contig Information
Length 922 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 316
Evalue 2.89009e-27
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18250
GACACTTCTCCTCATATGGGAAGGTGGCTGAGCATCAAATCATGGTTGACCATAGCACTGGCCGTTCACGAGGCTTTGGCTTTGTTACCTTCGAAAGTGA
GGACGCTGTTGAAAGGGTTATGTCAGATGGGAGAATGCATGATCTTGGAGGGAAGCAGGTTGAAATAAAAAGAGCCGAGCCAAAGAAACCTGGTGGTGGT
GATTCAAGCTCTAACAGTAGACATAGCCATGGAGGAGGTGGCCACCGTAGTTCATACCGCGGTGGAGGTGGCGGTGGTGGTGGAGGCCGTTCTGCCATCA
GCAGCAGCAGTGGTTATGGGTATGGAGCTGACTACCGATCAGCTGCAGCCGCCTACTATGGTAGTGCAGGATATGGTGCCTACGGTAGAGGGTATGGTGC
ATATGGAGGTAACCCTGCCTATGGGTCAGGTTTTGGCTCTGCTTATGGTGGTTCTATATATGGAGGCCCGTATGGTGCCTATGGAGCATATGGGGGTGCC
TACGGAGGTGGTGCATATGGTGCACCTGGCGGCTATGGTGCAGGTGCAGGCGGGTATGGTGGCTATGGGGGAGCTGGAAGCATGGGTGGTGGTGGAAGCG
CGAGTGGTCGAGGCTCGGGCAGGTACCATCCATACGGGAAATGAGTCCACAGCTGGTCCCTAGGATCTGATAATAAACACATACACCCGCTCATTTCTGC
TATGAGAAGTTGCAACACCCCATTGACTTTGTCGGATCAGAACATTTTGCATTCTTGCATTGCACTGGCATTGTATCGGACACAAATCTAGATTCTAGTC
ACTGAAAACTGAACCAGCCTGAGCTTCAGCTAAAACATTGTTGTATTCATTAGAACCCTTTAAAAGTCGAACCCAACTTTGTGATAGGAACAATATCTAT
GTGTTGGCACGATGTATTACAA
page-top