Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18186  (registered. 2003)
Contig Information
Length 656 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os01g0314800 [Oryza sativa (japonica cultivar-group)] >gi|113532404|dbj|BAF04787.1| Os01g0314800 [Oryza sativa (japonica cultivar-group)] >gi|125525617|gb|EAY73731.1| hypothetical protein OsI_01606 [Oryza sativa Indica Group] >gi|125570119|gb|EAZ11634.1| hypothetical protein OsJ_001459 [Oryza sativa (japonica cultivar-group)]
Score 227
Evalue 3.14913e-17
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18186
TTTAGAGGCATTTTACAAGGAGACAAGAGAGCACGGCGAGAGAAAATAGAAGAGGAAGATATCCTGAATTCCTGATCCCATGGAGAGAGTTGCCTCGCGC
TGTGTCAGCCTCCTAGCACAAAGGAGGGGCTACTCTGCGGCCGTGACCATGGTGAAAGGAGCTGGGAGGAGCGCCGCCGCCACCGAGGAGAAGACCGCTG
TCGCGGCGAAGAGCGCAATGGCGGCCAAGAAGGACGTGGGCACTGGCGCTGAGAAGGCCGCGTGGGTGCCGGACCCGGTGACTGGTTACTATCGGCCGTC
GGGCGGCGGCAAGGAGGTGGCCGCGGCTGACTTGCGCGCCAAGCTGTGCTGCTAAGCAAAGCAAGCGAACTAATTGACGGCCGCCCACCAAGAACATTTC
CTCCCTTAAGCATAATCGTAAAACTGAAGATTGTGAGGCGTTTCCACAGCTCTGATCGAGCATGGCTTTGCCTCTCTTTTTTTTTTTGAGGGGAGCATGG
CTTGGCCTTAAGATACGTGCTCTCATTGATCGCTATAGTCCACTTTCTCCTACCGCGGCGTGTCCAGGAGAATTCGCCTTCCTGCTTCTCTTCCCGATGT
TCGGCTGTTTGCTTGATACAAAAATATAATTTTGTACTGATTGATTAAAAAAAAAA
page-top