Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18185  (registered. 2003)
Contig Information
Length 1253 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit hypothetical protein OsI_38153 [Oryza sativa Indica Group]
Score 231
Evalue 3.30338e-17
Total Hit Count 110
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18185
GACATTTGATAATGCATTGTCCAGGAAAGTAAATGAAGTTGTGAACGAAATAAGGCGACAGAGATGCTCTTACTTGAGACTGAGACTGTGCCGAAAGGGC
GACCCATCTGGAGATTTCTTCCGTTCGCTGCTGGTCGAGGAAAGGCCACCAGGCGACGAGGATGCTGCGCCCGGCGGTGCTTCCAGGGGAGGGGCGTCGC
CTGCTCGTCCACACCCAGCAGCTTTCCAAATCCACCCGCGCCTACGAGGAAGGAAACCATGCCTTGAATGAATACCGTGCGTCGCTTATCCAGCAGAGGA
AGGAGCAGCTGTACGTTCTCATTGCCGGCGCCGAGGCCAATTCCCGCACCTTCTTGCTGAACAAAAGTCTGCTCAAGGATCTCTCTACACAAGTCAAGCC
TAGACCAGAGGACCCTCAATGGCGCAAGATATGTAGAACCAAGAAGGTGACCGACTTCACTAGGTCGGCGGGTATTCTTGTTATTTCTGGGCTCACTTAT
TATGCCTTGATTTCCCGTCCTGAAATCGTAAGGTATGGTGACTATCTTGTTACTGCTGAGAGTGTGCCCATGATACAAGAGAGGCTGGAGAGGCAAGTAA
TACAAGAGAGACTGCGGAGAGTTGCTACTGCTGAGGGAGTGAACAAGCAAGATGGATATCAGCCTGTTGGTACTGCCGAGGGAGTGGACAAGCAAGATGG
ATATCAGCCTGTTGCTACAGCTGAGGGAGTGAACAAGCAAGATGGATATCAGCCTGTTGCTAGTGCTGAGGGAGTGGACAAGCAAGATGGATATCAGCCT
GTTGCTACTGCTGAGGGAGTGAACAAGCAAGATGGATATCAGCCTGTTGCTAAAGCAAGTTGAATGGAGACGAAATGTATCTCTTGTTTGATGGAGAAGC
AAGACGATATCAGTTCCATTACAGCACTATGTTATGTATGTCTCTTGAAATATATATCCATCTATGATCTGCCACCTAGAACTTAGTAGTAGTATAACTG
GATGATATGTGATTGCATTGTAGGATATGTGTGATGTTGCTGGCATGCTATGTTACCCTTTGAGTCTAAAACTTGAGCAGTATTATAACTGGACGATCTG
TGATGGCGTTGTAAGATATATGTGAATTGCTGGTGTGGTATGTTGCCCTTTGAGTCTAGAACTAGAGTAGTATTGTCCTTTCAGTCTAGAACTTAGTAGT
AGTATAACTGGATGATCTGTTATGGCATTGAAAGATATCTGTGATGTTGTGGC
page-top