Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18153  (registered. 2003)
Contig Information
Length 724 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit hypothetical protein OsI_25228 [Oryza sativa Indica Group]
Score 468
Evalue 4.44142e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18153
ACCCTCCACGCGACGCGACTCCGCCGACGCCGTTCTCATCTCCGGCGATCTCTCGGGCCCTAGCGCCGCCCGCGTCCGCACCTGCGTGCAGCCACTCATC
GGCCGCGTCTTCTGCGCCCTCCCGCCTTGAACAACTCGCCGGAGTTACTGGTCGTGGAGATGGCCACACCACTCATAGCTGGACTTGCTGTGGCAGCCAC
TGCTCTTGCGGGTAGATATGGCATCCAGGCTTGGCAAGCTTACAAGGCAAGGCCCATAGTTCCAAGGATGCGTAAATTCTATGAAGGTGGCTTTCAAGCT
ACAATGACCCGACGGGAAGCTGGTCTAATCTTGGGTATCAGGGAAAACGTCCGTCCTGATAAGGTGAAAGAGGCACACAAGAGGGTCATGGTTGCCAATC
ACCCGGATGCAGGAGGAAGCCATTACCTTGCGTCGAAGATCAACGAGGCAAAAGATGTTTTGCTGGGGAAAACTAAAGGAGGTGGTTCAGCCTTTTGATC
ATATATCATGCAAAATGTGCTCACCCAATGAAGATACTATTATTTTTGCACCTCCAGACTCTGCACCTAGAACTAGAAGGCAGACAAAAGCCTTGGTGTA
TCACTGAAATTTCTGGAGAAAGAACATTAGATGTCTTAGACGTAGCAGGTTCTTTGACTGTTTGACACTTCCAAGACCAAAGTTGTGCTGGTTAAGGAAT
AAATGATGTACTACAAAAAAAAAA
page-top