Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18081  (registered. 2003)
Contig Information
Length 1674 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_02647 [Oryza sativa Indica Group]
Score 821
Evalue 1.88299e-85
Total Hit Count 203
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18081
CACGTTAATTAAGCGTCAAGCTTCTAGGAGGCTTACAAATGGATATTCGAATACTCCCTCCCATCCCATAATATAATATGTTGTCTATGAATGTAATAAC
ATCTTATATTATGGGACCGAAGAAGTAGTAGAAATGATCAATGTATATTAAGTTACAGAGGAAGTATAGAAGATAAAAAAACACCGATATTACAGATCAG
GTTTCAGTCATCCATGGTAAATTTCTTAGGAGCAAAAAGCACCGTCACCTCAAACTGCCCGTAATTTAAAACTGAGTCATCCGGGAACCTAACAGCTCCA
ACAGCTCCTTCCTGGAAAGTCCACCAAAACAATGATTCCTCCATTTTTAAGCAAATATCCAATTTCCCCTCAGCCTTCACCGCGACAACATACTGGAACA
GTTTTCCATTCCCAGAGAACTTATCATCAAACAGCACAATCTCACCATCAAAGCCACTAGTGAATGCAGTGAATCTCATATGATGAGGGCAGTCAATCTT
TGCAGAGACTTGTATTACAGCCTCAACACTCTCATCAAGCAAGAGATAGTCAATGACCAAGCTGCCAAGGTCACTACTAACCTCTCCATCTAGCATTTCA
TCTAACTCGTACATCCCCTCAAACTCAGCATACAAAGAAAGCAACTGTTTGTCAGATGACCCATCTCCTTCCTCCTTTACCCAAAGATCAACTTCTAGTA
ATGCTCTGTCCCTTACTATATACATTCCTCGACGAGGACTACAAAGAGGCAAGGTTAAGGAATCCTGGTCAACCGTAAAAGCATCATCTCTGCAGGGACG
GTTAAACACAAGATTCCGTAGTGGCTCCAAGGCATCCCGAACAGCAACAATTCCATAGACGCTAACGGGGTAGGAATAGGATTCGGAGATTGATAAATGC
ATCGCAAAGATCTGTAGCATCAGTCTTGGATCACGTAACCCAAGACTTGATCTAGTAGTGGAAGTATCATGGGTTTTATATTCACGGTGGTGGCAAAAGC
CCCTCAAGACACATAGACCTGTTGCCTCAGGGAGTATTTTGAGAGGATAAGAAGGAAATGTGGCATTCTCATCTTCACTTGCTTCAATCTCCTCACACTT
CTTCTGGTACTCGATGTTGCGTCTGGTGTAAATCCTACTCCATATATCGTCTACTTTCGCTGCTGTTGCCTCGGGAAATTTCTTCCCTGGGCAGTTTGTC
TCCTCGTTGTCGGCATCCACTGCCAGCGGATCGTAATCCATCAAGTCGGACAAGTTGACGCCATCAACAGGTTCAACACCAGCGCCCACGAGAATGTCGT
CCCAGCTAGGCAACTCAGATTCAGACTCTGATTCGCTCTCGAGGAACCCTCTCTCTTTCTTCTCCGCCAACACCACCACCACCTCCTCCTCCTCCTCCTC
CTCGAACGCATCAAGGAGACGATGGTGGGTAGAACCGAATAGATCTGGGGCGATTTCGAATCTAAACACATCGATGGGGGCCTCCTCGCGAGTCTCATGA
ACATGCCGGGGAAAGGGACCAAAAAGATCTGTGGGGATTTCGAAGCTGGGCAGATGGCTGGGATAGCAGTCGCCGGGAAAGGCATGTCCAGGACCCAGGG
GCTCCTTCGACGACAACATCGCGATGCTAGGGTTTCGTCGGCTGCGGCGTTGGCGGAGACGCGTAAAAAGCTCT
page-top