Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18053  (registered. 2003)
Contig Information
Length 1490 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit Os01g0306800 [Oryza sativa (japonica cultivar-group)] >gi|52075712|dbj|BAD44932.1| endoribonuclease E-like protein [Oryza sativa Japonica Group] >gi|52077520|dbj|BAD45322.1| endoribonuclease E-like protein [Oryza sativa Japonica Group] >gi|113532377|dbj|BAF04760.1| Os01g0306800 [Oryza sativa (japonica cultivar-group)]
Score 1565
Evalue 8.66506e-172
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18053
GCTCACCCGAGACAACCGGGAGTAGAGAGCTTCGGACGAGGAGATGGCCTGCTGGTTGGGGGCAGCCTGCAGAGTGGCGGCAGCGGGGGTCTTGCGGTCT
GAGCGGCAACGACTCAGCCTTCCTCTAGCACTGACGGCGGCAAAGAGGGCCAGCGTCTTGGAGCAGCAACGAGAGGAAGCAGCCGGCAGCGCTCGCGCTG
TCCAAGGGTGTGTGGCGAGCCCAACTACTACTAAGGTGACAGATAACCAAATGGAGAGTGAAGTCGCAATGGGCTACACGATGACCCAAATCTGTGATAG
GTTTATTGAGTTCTTCATGCATGAGAAGCCAGAAACAAAGGACTGGAGAAAAGTATTGGTTTTCAGAGAGGAGTGGCAAAGATACAGACCACACTTCTAC
AAGCACTGCCAAGTGTGTATAGATGTGGAAACTGATACTTCTGTGAAGCAAAAGTTGATTGTACTCGCTAGAAAAGTAAAGAAGATCGATGATGAAATAG
AGACGCACATGGAACTCTTCACAGAGCTCAGAGAGAATCCCACTGATATCAACGCTATTGTTGCGAGACGACGAAAGGATTTCACTGGGGACTTCTTCCG
CAATCTTAATTTTCTTGTAAATGCTTACAATGGCCTTGATGAGCGAGATGCAATTGCCAGGCTTGGGGCCAAGTGTCTATCTGCAATTCATGCATATGAT
TGCACACTGCAGCAGTTGGACATTGATTCTGCTCAATCAAAATTTGATGATATATTGAATTCTTCTTCACTAGATGATGCCTGTGACAAGATAAAAGGAT
TAGCTAAGGCTAAAGAACTTGACTCATCTTTAGTTCTTCTGATTAATAGAGCCTGGGCTGCTGCAAAAGACTCTAAAACTATGAAGAACAAGGTCAAGGA
TATAATGTATCATATTTATACAACTGCAAAGGAAAGCCTCAAAATCATCTCACCTCCAGAGATGAAACTTCTGAAGTACCTACTGAATATTGAAGATCCC
GAAGAGAGATTTGCTGCTCTCGCGTCTGCTTTCTCGCCAGGAGATGAGCACGAAGTCAAGGATGAAGATGCTCTTTACACAACTCCCAACGAACTGCACA
AGTGGATTAAAATGGTGCTCGATTCGTACCATCTCAACAAGGAGGAGACGGATTTCATGGATGCCAGAAGGATGAGCGACCCGGTTATCATCCAGCGATT
AATTCTTCTCAAAGAGACGGTCGAGGAAGAATACATGAAGCAATACATAAACCCTGAGGACCAAGAATCAGAAGACAGGGAAGAACCAGAATTTTGAGCC
TGCAACACCCATGAATCGGTGATGTTTGTAGTAAGATAAGATGTTTTGTAGGTTGCTAGGGCTAGTATTGGTCTTATGAAGTTACAGCCTTACAGAGAGA
TAGTTAGGTTGGTACCATGTAGCAAGTTAAGGTTTAGCTAGAACTTATGTTTTTTCATTACACTGATTACATGTTCGTATGCGATACAAG
page-top