Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18045  (registered. 2003)
Contig Information
Length 939 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 2
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit P-type ATPase [Hordeum vulgare]
Score 939
Evalue 1.70905e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18045
TTTTTTTTTTGACAAAAAAAAGTCTTTACACTGCATTCAAATGCAAATAAATCCAAATCCAGCAATAGGATTCTCAAGCCGGAGTTGACTTCCCAAACAA
ATGCAGCACCAAAAAGCAATCCTGCAGCGCACACTCGCACTACAAATGAATTCAAGAAAATTAGCGGCTGGCGATGCAACAGAGCCAAAATAGCAAATGC
AGCCTGGATCCATCCTGAAATCACCCTTCTCCAGCTATATGTCATCAGGGCCGTTGGCGAGCGGCTTGTAACCATTTGGACTTCCAGAGATTTCACCTGA
TTTAACTGGAATGCACTTCAAGATAGCTCCAATAATCAAGCTGATGGATCCAAGACCCACGCTCACCAACCAGAATTGCCAGCTGAGTGGAACAGTACTT
GCAAAAGTGCCGAGAAACTCGATGATCACCACTTGGAATACCACTGTCGCGCTTATTACCCCGAGGAAGACCCAATTGCCGATGAGACCGCGGAAAATGT
TGATCTTCTCCATTTCCCTGCTGTTCACTTCGTTGAATACCTGGCAAAACACGAAGGAGTTGAAGATGAGCGTGTTGAGAACAGTCTTGGAATCTGGACC
CTTGATGTTCAGAAGATTTTCCCCGGCGAACATGAGAACGCCAAGCACAACCAGCTGGTATATACTTTGCCCAATGATGTTTCTCCACATGACCTTGGTG
ATGAAGCTTTCCCCTCGCCCAGTAGGCGGCCTCTTCATCATTTCATCATTTGGAGGCTCAGTTGCCAGAGCTAAAGCCCCTAATGTGTCCATAATCATGT
TCACCCACAGCAGCTGCACAGCAGTGAGAGGAGCACTCCCTGCGATGTAAGAATGAGAACATGAATACCATGAGCCATTCGATGAAGAAAAAACCAAGAT
GTCAAATGAATACATCAATAATGTCTGTCAAAAAAAAAA
page-top