Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18043  (registered. 2003)
Contig Information
Length 942 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Homology (BLAST) Top Hit hypothetical protein OsI_02969 [Oryza sativa Indica Group]
Score 588
Evalue 8.58084e-59
Total Hit Count 83
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18043
TGCCGAGCTTGAGGACAAGTATGATGAAATGGATGCAATGGAATCACTCCACCATACTCTACTTATGAAGGAAAGGATAAGCAATGATGAGTTGCAAGAT
GCTCGGAAGAAGTTAATAGATGGTTTGCGGGATCTTACAACTGGCCGAGGAATTATAGGAATTAAAAGAATGGGTGATCTTGATCTGAAATCATTTGCGA
TTGCTTGCAAAAATAAAATGTCAAAAGAAGATGCAGGCGTTACTGCTTCCATTCTTTGTTCAAAGTGGGAGGAGGAGATTAAAGATCCAGAATGGCACCC
TTTTAAAGTTATCGTGGATGAAGGCAAAGAGAAGGAAATTCTCCGCGAGGATGACGAGAAGCTGCGAGAACTGAAAGAAGAGTATGGCGAAGAAGTGTAT
GGCTTGGTAACAAAGGCTCTGCTTGAAGTTAACGAGTATAACCCTAGTGGCCGCTATCCTGTACCCGAGCTGTGGAACTTCAAAGAGAAGAGGAAAGCAA
CTCTCAAAGAAGCTGTCCAGTACGTCCTGAGACAGTGGCGCACACAGAAGAGGAAGCGCTGAGCCCAGATATCTAAATTCCTGTAGTGAACTAGAAGTGC
GTTTCAGCCTGGTGTAGCATTGACATGAATGCTAGTACTTGGAGATTGTGAATCGCCCTTTCAGGATAATCTTTTTCGTGCCAAGCTATGTGCTAGTATG
AATGAACGGCTACTAGTTTGTTGATTTCAATGCATGTGATGCCTGGTGACTGTTTGGTGCTCGACATGCTTAACGAGCCCAAGAATGGCTTGCTGGAAAC
ATGCTTATCCTGATATTGTGTACTAGTTATAGCAGGAAAACCATCGCAAGCACATGATTTTATCTTGTGTTTGTCTCAGGCTTGTACTTATTTCTAGGAT
TATGTTGAGAGTCCAATATTTGTTCCTGGAATAAAAAAAAAA
page-top