Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18029  (registered. 2003)
Contig Information
Length 747 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Homology (BLAST) Top Hit hypothetical protein OsJ_007711 [Oryza sativa (japonica cultivar-group)]
Score 173
Evalue 7.57667e-11
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18029
GTAGAGTACGACGACAGTCATATGTCGATGGATCCTCATGTAGTTCTACTTCTCACCCTCATCCTCCTCCTGGGTACCGGAGACGGCAGCCTCGCCGTCG
GCACTCCGTCCGCGATCATCAGAAGGACATGCGCGGCTGTCGGCCGAACCGGCCCGGGAGTGGGTTACGACTCCTGCATGGACGCGCTCTCGGGCGACCC
GGCCGCCGCGGCCGCCAAGGACGCACGGGAGCTCGCCGTCGTCGCCACCAAACTCACAGTGGCCAACGTCACGTCGACGGTGCTCGTCCTCGACGACCTC
GTCTGTAACCTCGGGGAGTGCCTCCGCTCCTACAGGGACATGAACGAGACCCTGGAGGGCGCGCTCGGTGACCTAGCTGCTGGGCGCCTCAAAGCGGCGT
CCGACAAACTGCAGCATGTCTCCTTCGCGCCCAGCGACTGCGACATCCTCTTGTTCGAGGGGAGCGCGGAGAAGAACCCGATGAGCGAGGAGAACAACGA
CGCCGTGTGGCTGTCCCGACTGGCGTATGTGATTGCTAGCTTGTAGGCGCCGATCCTCGGCTCCGACGTCAAGTTTAATTCTTGCCTCACGCGGCTTATT
AATCTAGCTACGTAGCTAGCTGGTGGTTGATTTCCATTTGCTCGAGCGGTCGCATAAAATGGAATTGCCATTTGTTGTCCAACGTGTGCGATGTCATTTC
CACTAGTAGAGTGTCCGTTGCCACAGGCGACAAGCCATGTAAGTTTT
page-top