Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18014  (registered. 2003)
Contig Information
Length 736 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_VHS Shoot with heat shock treatment 4
Homology (BLAST) Top Hit pop3 peptide [Zea mays]
Score 399
Evalue 4.61361e-37
Total Hit Count 108
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18014
AGAGGAGAAAGCTTGGCTCAGCTTTGCACTTGTTGAGCCATGGAGTTCAAGCACCTGTGCCTGGTGAGGTTCAAGGAGGGCGTGGTGGTGGAGGACATCA
TTGAGGAGCTCACCAAGCTCGCCGCGGAGCTCGACACCGTCAAATTCTTCGGGTGGGGAAAGGACGTGCTGAACCAGGAGGCGCTGACGCAGGGCTTCAC
CCACGTCTTCTCCATGAGCTTCGCCAGCGCCGAGGACCTGGCGGCGTACATGGGCCACGAGAAGCACTCTGCGTTCGCCGCCACCTTCATGGCCGTGCTC
GACAAGGTGGTTGTCCTGGACTTCCCCTTCGTCGTCGCCAAGCCGGTGCCATCGCCTGAGGCCGCTTGAATGATACACCCCACCCCAGTATCTATCTGTT
ACTACTTCCTCCGTCTAAAAAAGCTTGAATGATATATACACCCCACCCCACTGTCTATCTGTTACTACTAAGCAAGTATAAGCATCTACCATCGCCAGCA
ACTGTAAGGTGCCTACCTTTTCAGGTAATACCACCATCTATCTATCTGAAGGCTGCAGCTGTGATGTACCTAAAGCCTCCTATTTTTTTGCTTGCTTGTC
CTGCTACCACGGCATTAACCGGCCGTCTAGCCTGTAAAGCCACTGTAAGGTGTAACTCTATTCCGTGCATTCCCTTCGAAAGTTGCTTGGTTATCACCCT
TGAATAAACATCGGTGGTTTTGCTTTAAAAAAAAAA
page-top