Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17992  (registered. 2003)
Contig Information
Length 793 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 5
Homology (BLAST) Top Hit Os11g0242400 [Oryza sativa (japonica cultivar-group)] >gi|62733863|gb|AAX95972.1| Rieske [2Fe-2S] domain, putative [Oryza sativa (japonica cultivar-group)] >gi|62733864|gb|AAX95973.1| Rieske [2Fe-2S] domain, putative [Oryza sativa (japonica cultivar-group)] >gi|62733865|gb|AAX95974.1| Rieske [2Fe-2S] domain, putative [Oryza sativa (japonica cultivar-group)] >gi|77549535|gb|ABA92332.1| Rieske domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|77549536|gb|ABA92333.1| Rieske domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|77549537|gb|ABA92334.1| Rieske domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644811|dbj|BAF27952.1| Os11g0242400 [Oryza sativa (japonica cultivar-group)] >gi|125533933|gb|EAY80481.1| hypothetical protein OsI_35659 [Oryza sativa Indica Group] >gi|125576731|gb|EAZ17953.1| hypothetical protein OsJ_032162 [Oryza sativa (japonica cultivar-group)] >gi|215695042|dbj|BAG90233.1| unnamed protein product [Oryza sativa Japonica Group]
Score 429
Evalue 1.75254e-40
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17992
TTTTTTTTTTGGAGAACAGCAGATTGCTCCACTAAACTTCACGCCGGAAATAATACAGTATTGTTGTACTCCTTACATGATGATAACAAGCAGCAATATC
TTGTTATTCACTCGATCCGGAAAGAAGTGTTTGAGTGAATAAACCACTTCTTTCAGGTTCGAGTGAATAAATCCGAAAATTAAACAAGCAGAAACCTAGA
TCTAAAATCTTCTCATCTTCTTTTGACATAAACCACTCAATGATCTCATCTGAGATACGGCCAACCGCAGGAAAATGGGATTTCTGAAGCCAGAAACTGG
AAGCAATGAGCTCCGTATGCTAACAGGGAGCAATACTGGCACAAAGAGAATGCTTGATAACACTCCACACTAAACAGAAAACATCTTTACGAGCTGAAAG
CTCTTGAAATTGCATAGATGAAGTCCAATAGACCAGTCCCCTTGAGAAGGCCTTTACCAGTTAAAAGTTCAAAATCTATCAACAATAGAAAGCCAATTAT
GGCAGCTTTTCCGTTGACCAGTTCATTGTAAGCAGTGAAACCAAAACCCCCTACACCTTCATCAACCACCATTCTCACCTCTTCGATGTTGACATCAGAT
GCAGTACTCCCTGGTTGAGCTTTCCCGCTGAACAGAATCTCAGCTGATCCACCAGAGCTAGCAGCGCCCCTAATGCTGATGTATATATTTTCTCCATCCG
TTTTTGCAGGGTACACGAATAGTTTTCTCAATACAGGTGTCAGAGCCCTTAAAACAGGGGTTTTTCGGATACCACTCTTTTATTTCCCCAGTG
page-top