Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17963  (registered. 2003)
Contig Information
Length 876 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit Os07g0678600 [Oryza sativa (japonica cultivar-group)] >gi|75326963|sp|Q7X996|CIPK2_ORYSJ RecName: Full=CBL-interacting protein kinase 2; AltName: Full=OsCIPK02 >gi|33146431|dbj|BAC79539.1| putative Serine/threonine Kinase [Oryza sativa Japonica Group] >gi|113612172|dbj|BAF22550.1| Os07g0678600 [Oryza sativa (japonica cultivar-group)] >gi|125559608|gb|EAZ05144.1| hypothetical protein OsI_27338 [Oryza sativa Indica Group] >gi|125601514|gb|EAZ41090.1| hypothetical protein OsJ_024573 [Oryza sativa (japonica cultivar-group)] >gi|189099605|gb|ACD76974.1| CBL-interacting protein kinase 2 [Oryza sativa Japonica Group] >gi|215706324|dbj|BAG93180.1| unnamed protein product [Oryza sativa Japonica Group]
Score 293
Evalue 2.98591e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17963
ACGAGGACTCTCCCTCGCACCACACCAGACTCTAGAAAAAGGAAGAAACAAACTCAACCTCCCACCCCCAACAGAAGAGCCGCAAATCTGCCACCACTCC
GCCGTCTCCCAGCCCCGCCGCCCACGCATCCGCCTCCTCCCTCCTCCCTCCCCTAGACCTACCCCGCCGCCCTCCTCGCGAGCGCTGCCGATTCTTCGCG
GAGGAAGGGAAGGGATCTAGCCACCTCCGGGGCTGCTGCTGCGGTTCCGTTCGCGTCGCCAGCCGCCGGGATCTGTACCTGGATTTCCACAAGGAGGAAC
CATCTTAGGGAATGCAGAGAGATGTGTTTGCATGCTAGAGAGCTACCTTGCGAGGGAATCGGCAGGGTAGCCACCCCTGTTCCTGCTTTGATTGACCTTG
ATGACACCGCTTCACAGCAGCACACAACACACCTCTTCTTCCATGTGCTTCTGCACAATGGGGTTCGACGTGGCATCTCAACCATCATCTTAGATTACCA
CCTCGGAGGGGACGGTTGAGGCTATCTAGCGCCCGCAGGCTCCCTTGCAAGGTTCGGGTTCGCTGCTGCTGTTCTGTGTGCGTAGCATACATCTGCCTGC
CGTCATGGGAGAGCAGAAGGGGAATATTCTGATGGGGAAGTACGAGATGGGGAAGATGCTCGGGCAGGGGACCTTTGCCAAGGTCTACCATGCCCGCAAC
ATCGAGACCTCGCAGAGCGTTGCCATCAAGGTGACCGACAAGGAGAAGGTTCTGAAGGGCGGGCTCACGGATCANATCAAGCGCGAGATCTCTGTGATGA
AGCTGGTGAAACCACCCAAACATTGTTCANATGTATGAGGTCATGGCGACCAAAACAAAGATTTACTTTGTGTTGG
page-top