Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17959  (registered. 2003)
Contig Information
Length 847 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 3
Homology (BLAST) Top Hit putative asparate aminotransferase [Hordeum vulgare]
Score 1153
Evalue 2.21276e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17959
AGAGATGAAGTGTCACAGACAGGACATACAGATAACCGCCGTCGCCANAAAAGTGTTACATGCATCGCACCGCGAATGCGGATCAGATCAGGCAGGCCTT
TATTCAAACAATCAATCAACAGCTACACGAAACCGCCCCCCCAATCACTTCTTCCTGAGCTTGGCCTTCATCCGGTCCACCGCGGCCCTCAGCGTGTCGT
CGTCCTTGCAGAAGGTGAACCTCACCAGGTTCTTCCCGTCCTCGGGGTTCAGGTAGAACACGCTCGGCGGGATGGCCACCACGCCCACCTCGCGGATCAA
GTACTCGCAGAACTCGATGTCGTTGTCGAACCCGAACGGGGTGTGGTCGACCATCACGAAGTAGGTTCCGCTTGACGGGTAGACGATGAAGCCCGCGGCC
TTGAGCCCGTCGACCAGCAGCGCTTTCTTTGCGCCGTAGTCCCGCTTCAGCTCCTCGAAGTAGCTGTCTGGTGCTCTCAGAGCTGCCGCCGCTGCTGATT
GCATCGGCGTGGAGGTGGCGAATGTGAGGAAGGAGTGTGCCTGCCTCACGCCCCATGTCAGGTGCGGCGGCGCTATCGCCCAGCCGATCTTCCATCCGGT
CAAGGAGAACGTCTTCCCCAGAGAGTTCATGGTGACGGTCCTCTCATACATGCCAGGAATAGAGGCCATTGATATATGATCCGCCTCAAATGCCAGCTTG
TCATAGACCTCATCAGCAAAGAGCAACACGTCATTTTCCTTGCAGAGATCAGCAATGAATTCAAGTTCCTCCCTTGTAAACATTTTCCCAGTAGGGTTGT
GAGGTGTATTGATCATTATTGCTCTGGTGTTCTTCAAACTGCANCCT
page-top