Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17952  (registered. 2003)
Contig Information
Length 1344 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 1
Homology (BLAST) Top Hit NADP-thioredoxin reductase C precursor [Hordeum vulgare]
Score 1778
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17952
AAGAGGTATGCACATTGTTGAGACGATCATGAGCAAGGGGTCAACAAGATGTTATATTGTACAACAAAGAATATATTTTGGATTCAATAAGGGCGGTCGG
TTAATTTCCTATGGCATCGGACTGCACCAGGCTCATCTGAGAATTTTGACCAAAAATTGCCCACCAGCGTGGCTTCTAAATATAGTCAATATATGTGTAA
ATGGAGGCCATTACACTTCAAAACCCTGGAACAAACAATGAGCTCAGCTCATTTGTTCGACTCGATGAACTCCCGGTATTCCTTCTTCATCTTCACACCA
GAGAAAGTCCTGATCATTTCTTTGTTTTTAAAGAACTGAACACACGGTGTTCCCATTATGCCTGCAGCTTCTGCTATTTCAGGGTCCTCCTCGATGTCAA
TTTCAACAAAATGAACGTATTCGTCATATTCATCTATAACCTTGTTCAAAATCGGTTTTAAGGTTCTGCAGGGACCACATGTTGGAGAAGTATATAGAAC
CAAGATGAGCCTTGGACTTCCATGGTATAACTTGCGGAGTGCATACTGTCCCTTGTGCTTTGTGTGAGTAATGTCGAAGCCCATCTCGACATCTTTGCCT
TCAATCTCCTTCTTTTTTTCTTCACGAACAGGCTGGTGAAATTCAACAAGAAGATCATTGGAGACTAAGTATCTTTCAACTGACAAAGCAGCTATACATC
CAGATCCAGCTGCAGTAACGGCTTGCCTCCATTCATGATCCTGCACATCACCAGCAGCAAATACGCCATCAACTGAAGTTTTTGCTGTGCCTTCGTCAAC
CAAAATATATCCAGAACTATCAAGTTCAATTTGACCTTGTAGCAGCTGACTGTTTGGAGTATGTCCTATCCCATAAAATAGACCTTTCACTTCAAGAACT
TTTTCCTCTCCCGTATCGATTCTCCTCAACTGAATACCAGACATCTGTCCTTTGGTATTGCCGACAACATCCACAGCTTCTGTATTGAAATGTACTGTTA
TGTTGGGGTTGTTGAGTACTCGGTCCTGCATAGCTTTGGATGCTCGTAGTTGGTCCCTTCGAACAAGTAAATGAACATGGCACGCATATTTTGTCAAATA
TATCGCTTCCTCGGTAGCTGTATCACCTCCTCCAACGACCGCAAGAACTTGACCCTTGTACAGAGGTGATGCTCCATCACATATTGCACATGCGCTGATA
CCTCTACTCCAAAATTCTTCTTCACGAGGTAATCTAAGTCGCTTTGCAGTAGCTCCAGTTGCAATGATTACACTATGGGATTTTACCTCTCGGTCACTGC
TACGGATAACAAACGGCCTATTCTTCACATCTATAAACTCAACA
page-top