Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7137  (registered. 2012)
Contig Information
Length 816 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|66277464|gb|AAY44603.1|| stress responsive protein [Triticum aestivum]
Score 426
Evalue 2.00E-117
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7137
GACTACTACCGCGAGACCTACGGCGGGTACGGGATGGCGACGCCCGGGTACGCGGCGCCGGTGCCGTACGGCATGTCGCAGGTGAACATCGACGGCAACT
GCGGCGGGCGCCCCATGCCGCCGCAGCCGACGGTGAAGATCTACTGCCGCGCCAACCCCAACTACGCCATGTCCGTGCGCAACGGCAAGGTGGTGCTGGC
GCCGGCCAACCCCAAGGACGACTACCAGCACTGGATCAAGGACATGAGGTGGAGCACCAGCATCAAGGACGAGGAGGGGTACCCCGCCTTCGCCATGGTG
AACAAGGCCACCGGGCAGGCCATCAAGCACTCCCTCGGCCAGTCCCACCCTGTGCGTCTGGTGCCGTACAACCCAGACTACCTGGACGAGTCGGTGCTGT
GGACGGAGAGCAGGGACGTGGGCAACGGCTTCAGGTGTGTGCGCATGGTGAACAACATCTACCTCAACTTCGACGCCCTCAACGGCGACAAGTACCACGG
CGGCGTGCGCGACGGCACCGAGGTCGTGCTCTGGAAGTGGTGCGAGGGCGACAACCAACGCTGGAAGCTCCAGCCGTACTACTGAGCCAGCCAGCGCGCG
CCGTGCATGCATCATGCATGGCTCGTGCACGTACGCGTGCAGATCGACATACACATACCCATACCTACCCATGCGTGCGTACGTATCTACTGAAGAAACG
ATGTGGAGTTGTGGTCTGTCCTGGATAAAAACATGCATGCGTCTCTCGCTATCTACGCTGCAGAATAACGGAGCTGTTGTGCTTGTATGTGTAATGACAA
GTTACGTAACAATAAA
page-top