Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17936  (registered. 2003)
Contig Information
Length 841 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit rhodopsin-like receptor [Zea mays]
Score 637
Evalue 1.47815e-64
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17936
TTGATGCTGGCGTGGCGTATTTCGTCGAGTGGGCTATCTTGATTGTTTCTGCTGTCTTGATCCTCCAGAGTTCTCTGGACTATCTCCTTGCATTTGCAGC
TTTAGTCTTTTGCATAATCATCAAGACAGTTTCAAGGATCGAAGGGATGTCAAGATTTATGCGCCATTTATCAAGTGGACTTTCCAAGGGAATCACACGT
GGCCTCTCCCGCTATGAAGATTTGGGAGGGTATTCCAACACGAATGGAGCTCACAAAGATGGGTTCAGCAAGCTTCATGGTGAATACCTGAAACATACGC
CAAGAAGAAATTCACCTCTTTCAGGCTCACAGAAGAAAACATCGTCACAAGTTCTTGATAGGGACAGCTACTATTCGACCTACCACACTACCCCAGAGAG
GAGAAAGTTTACGAAAGAGGAATACGAAGCATTCACCAAAGAAGAGACAAGAAAAGGTATGCAGCAGTTACTGTCCTCGCCGGATTTCAACAGGTGGGCG
CTCGCCAATGCGGACAGGATATCAGTGACTCCAGCAGGATCTGGACGAAGCAGCAGCAGAAGCCAGGAGCGACATCGTTTCTTCGGACTGTTTTAAGTCG
TGCGTGATTGCCACTCAGACAGATTTGTCGGTTATCCTGATGTGTTGAGTGCTTGCAGCAACATGTGTGTCTAGTGGTTCTACGAAGGATAGGAAAGGAT
AGGGTGGCAGCTGAATGTTACCACGTTTTTGGTGGCAACAGTCTTACAGTCTCTAGTGTTAGGTTAGCTATGAGTTCAAACATCTTGCTATTTTTGTGTG
CTCGGTAAAATTCTGATTGAGAAGTCTTCCCGTACTGGCAA
page-top