Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17820  (registered. 2003)
Contig Information
Length 1047 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group] >gi|215707233|dbj|BAG93693.1| unnamed protein product [Oryza sativa Japonica Group]
Score 519
Evalue 1.01947e-50
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17820
AAAAAAATCAAGTGCACTCGTCGGCGGCGCGGCGCGGCGGCTGCCTCCTCTGCTCGTCCGATCGAGCTCGCTTCGTCGGGTGAGCGCGGTCGATTCGGGA
GCTGAAGGGAGCATGAGTACTGCCAACGGCACACGGCGTGCCTCAAGAAGGCAATCACAAGATGCTGATAAGGTCGTCGTGAACTTGGTCTCAACCCCCC
CAGCGGCGGGCAGCCGTCGTGGAGTATCGACCTCTAACGCTGGCGCGCGCACCTCACCCATTGACGTGGAAGCCCTCGAGGATGAAGTGCAGGTCGTATC
AGCTTCACAAGTGCCTCCTCAGAGGAGGAACCGGAGACCTAGGAGGCAGCCTGTGACAGTAGTTGATCTCGATGTACATGCTACCCGGCAAGGAGTTTCT
CATGATGATAATGCAACAGTGCTTTCTCCTAACACAAGGAACAAACGCCCAAGAGTTGCTCCTGTAATAGACATCTCTCCAGAAACAGGAGAAGGGTCCA
GCTTACAGTCAAAAAATGCGGGGAAAACTAGCAAAGAGCATCTGAATGTGGCTCCAAAGGAACCCATCTTCACCTGCCCGGTGTGTTGGAACAAGTTGGA
TGAGCCAGCCACAACAATGTGCGGCCACATCTTCTGCACAAACTGCATAAAGCAAGCCATCCAGTTCCAGAAGAAATGTCCTACCTGCCGGAAGCACCTG
AAGATGAACAATTTCCATCGCATTTACCTTCCTAACACCTCCCGTTAAGGGTCAGGAGTCCTCCCAGGGAGAACCATGGTGGATCTTCTGCTGGGGAGCA
TTGTGTACCATCATCACCTAGATGAATGTATGGGAATGGGTCGGTAGGAGTTCATCGTCCTGATGACCGGACTGGATAACCTTCTGCCTGAAATGGGGTT
AACCTGATAAACAGAGTGGATAGCTTTCTGCCTGAAATGGGTTTAACAAATTTGCCTGTAGCCTTCCATTATATTGTTTGCGGCAACTTAAAAATGTTGT
ATGTATTAGGCTAATAGCCTTGTACCCTTTTCTTCTCAAAAAAAAAA
page-top