Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7123  (registered. 2012)
Contig Information
Length 965 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 6
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 5
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464311|ref|NP_001055755.1|| Os05g0460200 [Oryza sativa (japonica cultivar-group)]
Score 335
Evalue 6.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7123
TTTTTTTTTTCAGGCAGGTGTCCGTTTATATCAGGTTCGTTAAAGAATTATGGTAAGTAGCAGCTCTCCCAAGTTTCTCAATATTGATAGCCGAAGCCAC
ACAATTACAACAACCAGACCCTTAGAATATGCGTTGCGTTTTCAGAGTCAAAACCAAGACCTCCACAGGAGACAGGCTAATGGAAAATATACAGGGGAGA
AGTGAAATTGCTAGTGTCGGATGGACATTTGGAGATCGACAGCAAAACCCTCCACACCTGAAATGGCATGGCTAACTTCCCCAGTACTCCCATTTTATTC
AGAGCATTTCCTGGGATTTCCGTACGGCGCGCCTGACCTTCTTCTTGAACTCATCCTGCTTCTCTCTCCAGTCCTTAGCTGCTTCAATATTTGCCGGTGA
TTCATCATTTGGACTAGAAAGCATCGAAATGATGCTTAATACTATACTCTCAACCGTATGGACTGGTGTCCAACGCTCACTCGCGAGCTCGTATCCGTTG
GGATCATCACCAGGTGGATGAAGAATAGAAATGCATACCCGCCCATCCGGATAAACATTAGGATGCCACATTTCAGAAGTGAATCTGACTGTTGGAGGGC
TGTTCGGATAATTTTGTGGGAAGCTCATTATTGCATTGAAATAGCCTCCATCATATAGGGTCTCGGGCGGGCCGATGATGGTGACCTGCCACTCGAAGAC
GTTGCTGTCGTCGACGAGCCCGGCTGAAAACCCATCGACGGGGTGCTTCGCGAGATCTCGGAGCTGCTTCTGGAGGAGGAGGCTCGCCTGGCTGGAGGCG
GTGGCCATGGGATCGGCGGCGGCTAGGGTTTTCGCGGCGGGCGGGGCGGAGGAATAATTCGCGGCCTCGGTGGGCGGTGACGGGAATTGATGGCCGCCGC
GGGCCGCCTTATTTATAGGGAGGAAGCTCGGAGAAGGGAATCGGGACCAGAGGAGAGGAGAGAGA
page-top