Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7120  (registered. 2012)
Contig Information
Length 908 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242087069|ref|XP_002439367.1|| hypothetical protein SORBIDRAFT_09g005230 [Sorghum bicolor]
Score 298
Evalue 6.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7120
ACCGTTTGTATGGGAGAAGGGGACGATGAGCAAACTACAAGGACTAAAAGGGTGCATCAAAGCATAAAACCCATGGAGGCGACGATCTTGGGGAGAGAAA
GAAGCATCGCAAGCACGACTATCAGTTCAATGTAAACAAATACAAAAAACCAGTCCCCAATTTGATCAGGCTCGCCCCCTCCGCGAATCATCTAAGGGGG
GCGATATGTATCGAATGTAAGACAACGCAAATGGAAAAGGCATTGTTTATTACAGGCCTAAAAATACCACTCACGCTCCGACGCAGGCATCCTCCTCTCC
CTCCGTTATTCCAAGCTTCTGGGCACGAGACCTTCAAGTGTGGTGTTTGTTCTTTGCCATCAACGATGACAGAACCTCGACGAGTGTGCGATCTTACAGG
CTCTTGGCTGCGGCAATGACGCTCTCCGCGGTGATGCCGTACTCCTTGTAGATCTTCGGGGCAGGAGCGCTGGCGCCGAACTTGTCGATGCCGATGGTCT
TGCCCTTGGATCCAACGTACTTTTGCCATCCGAGGGTAGAGCCAGCCTCAATGCTGATCCTTGCGGTGACAGCCTCAGGGAGCACGCTCTCCTTGTATTC
ATCTGACTGCTCGTCGAAAAGCTCCCAGCAGACAAATGACACAACGCGGACAGTCTTCCCCTCCTTCGTCAACTCTTCGGCAGCCTTCACAGCAATCTCT
ACCTCAGAACCAGTGCTCATTATGATGAAGTCAGGCTTGTTGTCGGTCGAGTTGTCAGAGATAGTGTATCCACCCTTCGCAACGCCCTCAATTGAGGTAC
CAGGCAGATGAGGAAGCTTTTGCCTGGAGAGAGCCAGAATAGATGGCCTCTTCCTGTTGAGGACAGCCACCTTGTATGCCCCGGCAGTCTCCTTGCCATC
AGCAGGAC
page-top