Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17750  (registered. 2003)
Contig Information
Length 957 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit Os01g0772600 [Oryza sativa (japonica cultivar-group)] >gi|20160915|dbj|BAB89852.1| putative serine/threonine protein kinase [Oryza sativa Japonica Group] >gi|113533924|dbj|BAF06307.1| Os01g0772600 [Oryza sativa (japonica cultivar-group)] >gi|215767990|dbj|BAH00219.1| unnamed protein product [Oryza sativa Japonica Group]
Score 614
Evalue 5.69841e-82
Total Hit Count 65
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17750
AATGAGCTCACGGAATAATGGAATCGATACACCGAATTCATGAGTTTCACCTCACATAATAATTTAGACACTTCCAGTCTATCTGAGAATATGGAACTTG
TTTCCACTTACAAAATGAAGGACATGATAGAGCTATATACACAACGGGCTCTCACAGGTTATAGGCCTCCAAAGAGGAGGAGGCCGTCATTCATACTCTG
TAAAGCAGCAACTGGACCGACGCAAAAGCATACTGCACCACCACCAACCGGATCACGCATCCTCTTCCATCTTCTTATTGGCTAGCTGTGGTCCACCTTC
ATCCCAGTTCTTTCTGGAGCGCCCCTGCTCTGGCCATGATGTAAGGTTCATCTACGCAATTTACCTACACATACAGAGTAACACAGCAGCAACTAAATTT
GCTGGGTTTTTCGACGTCAACTCATTTTAATATGCTCAGCCCTGACTGAGTTGGTGTGACTGCAAGTCTCACGACACTGTCCGTCCATAGCATATAGAGG
CAATGTAAAGATTTTTGGCCCATTTCTCCTTCACATGGTTGCTTGGGAAAGTGGATGTTCTAAGAGTTTCTTGTGTCTCGTCCGTCAATTTTCTTTTGGG
AATGCTCAATATAAAAGCAGCTTGATCACCAGTGGCTGCTGTAGAAGTTATTCTATATCCATTCTCCCATCGCCGGTGAATACCTTCACTAGGATAAAGA
AAATCCAATTCTACCACCTGTTCAGAATATCCAGAATTCCTTGACATAACTACACCCCAGCGGGTCCCTGCTGTAGTCATTGATGTAACATGAAATCCTT
CTTTCCATTTCTTGTTGATCCACCTTGAAGGGGAAATGATTCACTGACTTTGTAAGACTGTTGAGTGTAAGGGGTTCCTTTTGACATGACCACCAAGGAA
CTTCCGTTTGTTGCTCCTGCTATGGCACTGATGTAGTAGTTATTTTCCCACTGCTCC
page-top