Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17661  (registered. 2003)
Contig Information
Length 586 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 6
Homology (BLAST) Top Hit unknown [Zea mays]
Score 548
Evalue 1.42959e-54
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17661
ATGCATGGTACGGGCAAATGCTAGCGAAGGGAGAACTCAGGCTCGATATGGGTGACAGTATCAAGGGAAAGGGGATGATTCAGGGTATTTCTGCTGTTGG
TGCGTTTTTTGAGCTGCTCAGTCAACCCAGCTTAAGTGTGCTACACCCAGAGGAAAACAAGCAAGTTGCTCCTGCTGAACTGTGCCCGATTCTGAAGAGG
CTTTATAGAATTCTGATAAAAAGGGAGCTCCCAGTGGGAGACATCCTCCAAGCCCTGAGGGACGAAACCATGAACGACCCTCGTGAGAGGATCGAGATGG
CGCAGAGCCACACATTCTACCGCCCGTCTCTCCTTGGGAAGCCGTGACCTCGGTTGCCCCGTGTACATGATTAGAATGTAAACAAAAGGCTTGGATTAGC
TCCAACCCTGTCATGCTTCACATCATTATCGGTTGAGCAAAGGCGTCTCCGGGTTTCTGCTGGCTTCTGTGTTTGGATCCCAGGCCCCAGCGGCCATAGT
TTGTGGGGGTCGTTAGACTGTCATGTTGTACAAGAGAGTATTGATCGAGTGAATAATATGTTGCTACTTGGACAATAAAAAAAAAA
page-top