Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17657  (registered. 2003)
Contig Information
Length 1190 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit hypothetical protein OsI_02889 [Oryza sativa Indica Group]
Score 814
Evalue 7.69203e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17657
CATTTTCTCCAATAATAAGAATGAAATGATACAATCCATAGCCAAAGCATTTCACTACAGAATAATTATGTATGCCCACTTGTTTCTGCCACATGTGCAC
CAAAATTCCTGAGCACACGACTACGAAGTCAGAAGCCCCATTAAAATGGTCACCGGCAAGTACTCGCACTCTTTTCGCAAAAAAAAAAAGTACTCGCACT
CGCACATGCGGTTTCTTACATACACATAAGCTAGCTAACGGTTATACGGATGAAGCGGCCTACCAAATGGAGGATACTGACCTCCCTGTCCGGGGAAGCC
CATCATCTGCGGCCCGGCACCAGGAGGAAACTGCTGATTGCCATATACTGGAAACTGCGGCATTGATTGCATATGACCTTGTGGAAACGGCGGGCCTCTA
TAACCTGGACCTTGCATCATTTGAGGACCTGGAGGTAGCTGCTGCCTTCCATGGCCAGGGAACGACATCGCTTGATGGTTGGGCATCTGTTGATTTCCTT
GGCCTGAATGCTGTGACATTTGAGCTTGATTTGGGCCTTGCGGGAACCCTGGGGCTCCATAGCCTTGTAGGACTCCCTGGCTGGCGTACTGTTGAGGTCC
ACCTGAAGCGGCTTGTGGGTGTGGCTGACTGGAAGGAAGGGATGGTGCTCCTGGTGTTGCCAGAATAGATGTAGTCCCTGGTGCTGCTACTACGTCAGCT
GCTGCGGAAGGAGCACTGCTGTATGGTGGCGCAGTAGAGCCAATTGGCTGAGGGCCAAGAATGGAAGGTTCATGGTTAGCTGGAGCACTGTTCCCCCCAG
TGTAATCTCGACCTCGCTCATTGTTGATCCTAACATTAAGATCGGTATGGCGTGAAAACGCGAGGTGAAGCTTGCAATATCCGCCTTCATAGATGCTGTG
TCCTTCTAATGCTTCTCTTGCTTTAACTGCAGTTTGAATATCTGGATACTGGATTAGTGCATGGAAGCCAGAGTTCTTCTCAAAAATAGCAATCTTTTGT
ACAAACCCAAAAGCAGAGAAGACCTCGTGAAGAGCATCAATTGTAACAATATACTGCATATTCTCAACTGACGCAAGCAGAACATTGCTCTCTGGCTCCT
CCTTCTTCCCATCCTGGGCCACTCCAGATCCATCAATAGCAGAAGGTGCAAGGGGAAGGTATGGGTTTGTATAATCCCTACTCCTATGAC
page-top