Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17644  (registered. 2003)
Contig Information
Length 1188 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 4
Homology (BLAST) Top Hit hypothetical protein OsJ_001714 [Oryza sativa (japonica cultivar-group)]
Score 1594
Evalue 2.74279e-175
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17644
TACGATGATAAAGTCTTACAATCTGGAAGTATTTTTTCGCCAGCTAATTTAAGAAGGGATTACATGAAGGAGAAGGACCAATGAAAATGCTGCAGTATAG
AACTGCCAATACTTCTCTTCATCTGATAAAGTAAGAACTGCTTGGATTCATGGGCATTTGTTCATCCTTCCTTGTGTATTCAGAGCCTTGTTCTATTTCA
AAACTACTGGTTGATGGTGCACTGAGAAAGCTCTCTGTATCAGCATCGTGATGCATCCAAGGATGTTTGGAAAGCCTCCTTAATCTGGTAAGCTCCATAG
ATACCTCTTTCATGGAGGGCCTGTTGTCACCACACATATCCAAGCATTGCTTTGCTAGTTCCGCTAGTCCAGTAAGCAGCTCCATGCTCTCGTGATCTTT
TATTTGACTATCCAACATGGCATCAAGGTTGTTCTCCTTCATAGCCACTAGGAAACATGATGCCAAGCTTCTTTGTGACTCATTACCTTCCAGTTTTAGT
GGCACCTGCCCAGTAAGGACTTCCAAAAGGACGACACCAAAGCTATAAACATCGCTTTTATCTGTCAACCGACATGTCTGCATATATTCAGGATCCAGAT
AACCACAAGTCCCTTGAACCATTGTCACAAACTGGGCTTGATCAGTTGGTACTAGTATGGAAGCCCCAAAGTCGGATACCTTTGCCATGTAATTGTCATC
AAGAAGGATGTTAGAAGTTTTCACATCACCATGTAGAATTGGTGGGTTTGCATAGGAATGTAAAAATGCAAGCCCCTCTGCTGCCTCATTTACGATCCTT
AAGAGCGAACTGAATGGGATGTGCCGTGTGCGGTTCTTTCCGTGAAGAAGATCAAACAATGTTCCTTTTGGGATGAACTCATACACCAGCATTGGGACTT
CCACCTCCAGGCAGCAGCCCAACAGCTTGACGATGTTCTTGTGATTGATCTGGGAGAGAATCAGCATTTCTTTACCAAATTCCTTCTTATGCCTTTCATC
AATCAATGCACATCTTTTGATTGCCACTGGATTTGTACCCTTAATAATGCCCTTGTAAACAGTCCCATGGCCCCCATGTCCTAGAATTTGGCTTTTGTCA
AACTTGTTTGTTGCTTCTTCTACTTGTGCTTCAGTGAATACCGTAAATGCAAGTCCCTGGTCGGATTTCATCTTCTCGAATAATAGCA
page-top