Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17642  (registered. 2003)
Contig Information
Length 2456 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein OsJ_020002 [Oryza sativa (japonica cultivar-group)]
Score 513
Evalue 2.13864e-71
Total Hit Count 373
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17642
GTTTCTTCAGTTGAGCAACAGGGAAACCGCCCTGGCAGAGCCTCCCACCGCTTCTGTCTGCGAACCGCAGAAGAATGCTGAGAGTCATGTACGTGGTGGA
ATGTCTACTCCGATGGGGATACTAGATGCCCCAAAGCAAATTGCTACCCAGTCAATTACAGCATGTACTGAAGAAACAAATAGCAGTCTAAGCACTCAAA
CTCCTGCACTTCCCATATCCAGAGAAAGTAATCTTTCCATGGGTGACAAGCAAGGTGTTGGAGTTTATACCATACATGGACAAACAAAGATGGTTTTGGC
TGCAGAACTGGCATCTGCAAATGATGAACATAAGCTGCATGAAGTACATGATAAGACTGCTGATGGTAATATACTCCAACACAGTGCTGCAAATGACACA
CTCCAGGATAAAACTGATAGCATTGCTGGTTTGGACCTAGCCTCTCGTCATAGAATTGGTGATTTGGAAATGGAGAAGGGTGATTCTAATACAGTGATGT
TACCAGACTGCCAAACCCCTTTTGATGCCTCAGTTAAGGATATTAAGGATACTCTTGCCCCCACAGAAGCTGATGTCAGTGATCTGCAAAGTGAGGCTGC
TGCTATTGATGTGACTAGTCCTAAGCAAGATACTATGGTAGTTGAAGCACTGCACACTAATTCCGGAGGTTCTGCTAGTCATCTGCCTGCTGCTTTACAA
TCAACGGACTCAAACCAGCATGCAGAACGGAAAGGAAGTTCAGAGAACAGTGGCTCTAAATTTTTTGCATCTGGGAAGAAAACAGAGGAAATGGAAGGAA
CTTTGGATAAGAATACGGATAACAATCTTATTCAGGCAAATGCCGATATAGCTTTAGGAAGACATTCTCCTTCAGAGGACAAAAGAGAGGACAGTTGTGC
CCATGTAGTTGATGGTGGCCTGTTGGGAAGCAAACAAACTCTTCTTGAAGTCGTTTCTGCTGTAAACACTGATGGCTCTGAGGAAGCACTCAATGCTTCG
TCTACCCATTCGAATAAAGATGCCACCTCGGTTTGTGAAGTAACAAAGGATCCTGAGAGCCATGTAAGAGTGTCTGTACTGGCCTCTGCTGCTATGAACG
CTCGTGATGACTGTGAGGAAGTTCACAATGTTCCATCCACCCATTCTGATAGAGGGGGCAGCATGGTAGAAGTTGATGCGTCTAGAGATGATGCTACCTC
TATTTGCGAAGTATGCAAGGATCCTGAGAGTAATGTATCTGGTGAGTTGTCGATGCCAGTAGGGTTAGCGGAGCTCGAGTTAGAACTGCCAAACCAATCC
AAATCTTCTAGCCAGTCAAGCGCAGTAAATGCTGATGAAACAAAGGCCAGTATCAACATTCAGACTACTTCATTGGTAGAATCAGGAGAACAAAAATCAC
CCAGAAATGGTGCACATGAGTTGAAAGAAGGGATGGAGTTGGCCGGGCCTAAGATTGAGTGCACAATACTAATGCCGAGTCCCGATGATAAGAGTTCTGA
GGCTCATAGTTTGGCACAACGGGAGATGGTTTCGGGTGCAGAACAAGCATCTATGAAAGATGATAAAAGAAACAAGATGGTTGATGTTACATTTTCGTCT
GGTGAGGAACAAGAAATACAGCGAGCTGATGTAGACTTGCCCACTTGTCCAAGATATGCAGATTGTGAGGGTGAAAAGGACCATTCCCCTAAAACTATTT
TGGCAGGCAGCCAATCTTTTTGTGAAGCCTCAGATAAGGACGTTGCCCCAGTGAAAGATGATCACACTGATCCGCAAAGTGAAGTTAATGTTGTTGATAT
GAATGGTGCCAACCCAAGACTCAGCTGAAACCGAAGCTATGCAGATTGATGGTGTCTCCAAAGGATCTTCAAGTGATTTGCCTGCTGCTTTACGATCGAC
CGATTCAAATCAGCCGGCAGAACAAGATGGATTAGAGAATAGTCCCTCTATATCTGCTTGTCCGAAAGAACATGAGAAATTGGAAGAAACTTCTGATGAA
ATTGGTGGTGGCAATTCCAATCGTAGTCGGACTGATGGTGATTCTCATATTATGAATCTAGTTGGTTATTCGGAAGACTCAGATGAGGACAATTCTATCC
AGGTAGCTGATGTTGGTGATGTGGGAAGTAAAGAAACTACTCATGATGGCATCTCAGCTGTCCCTAGAGGAGCAGAACCAGGAGATGGACCCTGCACAGA
GCCTACTTGTGAAACTGCTGTTCATGTGCACGAATTCAATGTGGACGTTGCTATTTCTGAGGATGGTCATGGCACAATGGCCCTTGGCAGCGTCCAAGCG
TCTACGACGGAACTAAAGGATTTGGAGAGTGGAAGATGTCTAGAACATGGAACAGGAACCCCTGTGGCTCTTCAGGAGGGAACTGCTGTCGCTGCANAAC
CANAAGCAAAGAAAGAGGTCGACNAACCTAAAGATGTTGAGCCGGCTGCCATAAAG
page-top