Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17631  (registered. 2003)
Contig Information
Length 859 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit plastid-lipid associated protein 3 [Zea mays]
Score 759
Evalue 1.10497e-78
Total Hit Count 191
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17631
TTCCTTTTTATAACACAAAAAATGTACACTACGTAGTTACCAAGGAGCAGAAAGCGTATGGAGACTCCATACCGACAATATTTAGTTGATTCTGCCAGAC
TCAAAACCACCAGAAAATTGTGTATCAAAGAGGGAGAAGAATGCTCCGTTGTAGGCTTGCAGCTGTGGTTTTCAACCTTGCAGATATGAATAATGACACC
TATTACACATGTACAGTTAATCTAGTAAAGGGCTCCCCTCTTTGGCAAGAATAAACACGCCACCTCCATCGCCTTTTGAAATCCTCAAGTCTTTGTCCAG
GTAGGTTGTCAAAAGCCACGACTTGGCCTTGTTGTCTCCGGGAATCGGTACCTTGAGGGGTGGCTGCCCAGATATGGACCCTGCAATGCTAGCAAATGCT
CGCTGCAAAGGCTCCAGCAGCTCCTTAACAGGCCCCAGGCTGAACTTCTGCCCGAATATGACGATCTGTTCAGGTAGATTTACTGATGATGATATCTCAG
GAGGCTGGAAGCTCCCCTCTTTGAATTGGACCTCTATCCTTGATGGAGTTTGGACTTCAAAAGAAGCAGTTGCGCTAAATGAAAACGAAGCAAATGGAGT
CGAAATAGTTGAAGCATTAATTATCGTCATGCTTCTCGAGTCAATTTCTTGGGATATCTTATCAACTCTGGTGAATGGTGTTGCCCCGGCAAGCAGAATC
GGTAGAAGCTCAGAATATGCTGTATACAGGAGTATCCAGTTTCCGTCGAGCTCTGGCGCCTGGACGGGCGCGGGCGTGGGATTGGAAGCCTCGAGCTGGG
CCACGAGCTCCACGACCTCCCCCCTGACCTCCGAGGACGTCTTAAGGCCCAGGCCCTCG
page-top