Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7106  (registered. 2012)
Contig Information
Length 1466 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115455467|ref|NP_001051334.1|| Os03g0758600 [Oryza sativa (japonica cultivar-group)]
Score 449
Evalue 4.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7106
ACCGGCCAGTCAAGGTACCTCGCCACTATCTCAAGAATTACAGCAGGCCTCTCAGGCCCTGGACCCAGCTTAATACAACGCTGTTACAGAAATTGTCACA
TATAGACTAGTTTAAGAATTTATTATAGAAAAAAAATGTACATCATGTTTCGACCCGAAAAAGGCATGGAATCTCTGAGGGGGGAGGCCAGCCAAACAGG
CCAGCAGAGTATGCACACTCATGGCTGTGATTTTTTTTTCTTTTTACCTTTATACCAGTCCACCGCAATCTCGATGGCAAATCCGAATCCGAAACCGACC
AGGATCAGAGGTCGTTCAGGACGAAGCTGCGATGCTATTGCCCGATGGGCATCGTGGCTTGCGACACCGCCTTGTTGTTCGCCCCCAGCTAACCATGCCC
CTTTCATCAGCTTCTAAGCCAACAGAGTCGGGTTTTGAGGGTGGTGGGCTCGCCTCGGCTTCTATCTCTACGGTAGCTGGCTGGTCTTTGCGGGGCTTTC
TACCTCTTGTTCGCCCACCGCGCGCTCGCCTGGTTAAACTCGACTCCCATGATCCACCAGATGCCTGTACTAACCCCTCAATTAGCTGAATGTCCTCTAT
GATCTTAGGCCGGGAAAGCGATGAAAGCCCGGGCAAGATGTCCTTCTGGAAGTCTCGCTTCTGCCGTCGCTTCCTTTGCGGTCCTCTTTTTGGCTTGGAC
AGCAGGTTCACCGCTGAAACAGCTTGGTCATCGTCTGTCAGTGGTGGTTCTGGTGTCCTGGTCCAGCGCTCATCGGTCTTGCACTCTTCCAGCTTCAGTG
TCAAGGCTTCAAATGAGTCTGAACCATCATCACTGGAATTATCGATGCAACCCTGGACTTTTGCTTGCTCGGCATGGTCATCCATGCTTGATATCGCGAG
CTCTGCAAACCACTGCAACATATCATCGGGTGTGCCTGTGGTGGTCGGCACATCCGTTGACAACGCAAGAATAATCTGCGCTGCATCTGTAGCGGATGGA
AAACACATATCAGCTTCCTTGGATGCACCAAGCTTGCCAGAAGGTGTGCATTCCTGTTGAGAAGTCCAGGCAGCACCATCTTCACAAGCTGGCACTTCTT
CTAAGTCAAACAAAAATGTGCGCTTAGCATGGTTGTTCTGTAAGGCCACCACATCACATTCATGTGACACTACTGATGACTCTGAGTTATCTTCATGTGG
TACATCATCATTCAGATCAAACAAATTTCTGACTACAGCGGCGCCACTTTTCTTGACAACACCTTCAGCAGCTTGTCCATCTCTATCCAGGGGTTTCTGG
CTTGAAAGTGGTAAATGTCTCGTAGTACTCTCCTCAGTCTTATTACATACCAGCCAAGTTCTATCAGTGATGCCTTCAGAAGCATCATCTATCTTAATTC
TGCAACCTAGGGACGTCGAGGCAGAATCTGACAAATTGCAAACAATCGGTGTTATTCCTGTCAAGT
page-top