Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17584  (registered. 2003)
Contig Information
Length 1236 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit Os01g0926600 [Oryza sativa (japonica cultivar-group)] >gi|20160727|dbj|BAB89669.1| P0482D04.16 [Oryza sativa Japonica Group] >gi|20805225|dbj|BAB92892.1| putative pectin-glucuronyltransferase [Oryza sativa Japonica Group] >gi|113534794|dbj|BAF07177.1| Os01g0926600 [Oryza sativa (japonica cultivar-group)] >gi|125528941|gb|EAY77055.1| hypothetical protein OsI_05013 [Oryza sativa Indica Group] >gi|125573177|gb|EAZ14692.1| hypothetical protein OsJ_004517 [Oryza sativa (japonica cultivar-group)] >gi|215687152|dbj|BAG90922.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1588
Evalue 1.45093e-174
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17584
CGCATTAAGATCGGCATCTACTGTATAGCAGTATAATACAAAGGTCATGCATATATATAACACTCTATGATCCATGATCACCTACAACAGCAGCAGTCTA
GCACTAGGGCAACAAAAAACAAGGGAACCATGCCATGCCATAACATGGAAGGTAGGCAGGCACATCATCACAACAAAAAGAAGCAAGGTATTAGACAGGA
AGGAGCTTTACATTTGATGACAGTAATGGCTTAGCTTGGCTTGGTTTTGGCTGGGCTTACTCATCCATCAGTCCTCTCAGCTGGTTCAGACCGACTGAAC
ATCATCAGCTCATGGCGCCAATGCCGGTGCCGCGGCTACCTACCATGGCTTCAGGTCGCCCTTGGGGCCCTGGGTCCAGTTCAGCGCCTTCTGCCCCGGG
GTCAGGTACACGCTCTTGCTGTGCGGGAGCTTCCGCGCCAGCCCGTTCAAGATCTGGTGGAAGGCGTCACCGGGCTGCGCGGGCTGCGGGAACAGCATGG
CCTGCTTCATCGACGGGTTCGCCAGCAGCCGCTGCTTCCGGAGGATCACCTCCATGGGGATGGAGGTCAGGATGGTGTCAAGCTTGGGCACGTCGTCCTC
CGCGACGAACACGCCGATCTCATCCCACGGGATGGCGTCCGCGAAGGGCAGCACAATGTCGTCCGCGATGATCACCGGGATGCACCCGAACACCACGGCC
TCCACGAGACGGGGGCTCCACGGAGCCCAGCCTAGAGGGCACAGGCAAAAGATGGCGCGCTGCATGTCCTCGTAGTAGGTGGGCGGATGGTCCGTTGAGA
TGTCGAACAGAGGGTTGTTCTTGAAGTTCTCCCACACCGAGGCACGGGCGCCTCTTGCATAGTAACCACCCTCGGGATCATTCGCCGTATCGTAGAACAA
ACCACGGAAATACACAAAGATGGAACGCGGGGTCTCCGGGGGAACAAGGTGAGTTTTCATTTTCTGGGGAGGAGCATATGGTGGGATATTGATTGAGCCC
TCCTTTAGGCAGACATGATCCTTCTGCCCGAATGTCTGGACAAGTGTAGCGCGGCGAAGCAATGGAAGGATCCCCCGTTCAATCGCCTTTTCTTCCTGAT
AATGGAAGCATGCCCCAAAGTCATGCGGCACGACAAAGAAATGATCAGCACCCGCCGTCCGGTTCCAATAAGGCCAGTGTGATGAGATGAACTGAACCGC
ACTCCTCATGATCCGCGGGGACTTGAAGGGCAAGGG
page-top