Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17572  (registered. 2003)
Contig Information
Length 1092 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit hypothetical protein OsI_29176 [Oryza sativa Indica Group]
Score 678
Evalue 3.98987e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17572
TTTTTTTTTTGCAGAATGTATACTTAAAATGACATCAGAAATACACTGAAGTTACTTATTGCGATCATCCTAACCCAGAAACGTTTTCGCTGGAACAAGT
TCACTTACGAAGTATCCATGTCGGAGCAAAACAGCAGAGCCATCCCCAGAAACTATCAGCAACTTGTTACTGCAACCCACGCACACATCAACACTACAGC
AGCTCCATGTCAGCTGCAGTAGCTGAACCATCGGCGTAAACAGGGTGGAGAGTGTGCCCAGCTACAGGTTCGACATGAATCCATTTCCTGCCAGTCAGCT
TATTCCGTTCGAACCGCACATGGCCTTCCTTCAGAGAGAAGAGAGTGTGATCCTTCCCCATGCCAACATAGTTCCCAGGATGGAAGCGGGTTCCTCTTTG
TCGTACGATGATGTTTCCTGGTTCCACTTTCTCTCCACCAAATTTCTTAACACCCAGATACTTGGGGTTAGAGTCGCGGCCATTTTTCGTTGACCCAGCA
GTCTTTTTTGTGGCCCAACGCCTAAAGACCAAGCTCATTCCTCCAGATGTCTCTGTTGAGCTAGTGTAGACCGGAACATTTGAGATCAATTCTTTGATGT
TTACTCTCCTGAAAACTGATGAGAGGGCCATCTTGCTTGCCACAGTTTACCTGTAGTCACTTGCTTGCGGACGGGGAGGAGCTGAGGCGACGGGCGATGG
AGGTGGAGGCGGCCCCCGGCGGCGGCGGCGCGCTCGTGCACAGATGCGTCGAAGGAATCCTCGTGCCGTGCCAGGTGTTATACCGGTAGCTTCAGGTGGT
ATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGACGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCAC
CTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGCGAAGGTAATGAAATTATCCGAGCAGC
TTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGAGCCGGTAGATACTATTGATAAGTAGA
page-top