Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17514  (registered. 2003)
Contig Information
Length 1290 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit Os02g0739600 [Oryza sativa (japonica cultivar-group)] >gi|46390562|dbj|BAD16048.1| putative pyruvate dehydrogenase E1 alpha subunit [Oryza sativa Japonica Group] >gi|113537599|dbj|BAF09982.1| Os02g0739600 [Oryza sativa (japonica cultivar-group)] >gi|125583627|gb|EAZ24558.1| hypothetical protein OsJ_008041 [Oryza sativa (japonica cultivar-group)] >gi|215704394|dbj|BAG93828.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1682
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17514
TTAATTTCCCCTCATGATTTTGCGAACAGAAGCGATTATGCAGGCCAAATCGCCAGCTAGCAGCAGTTAAACTGAATTGCAGGAAGAGAAAAAAAAAGGA
AAACATAACAAATAAGGAACGAATTCCCCTGACATCACATCTCTATACAGGTTCGTTTTGCAACAAATACTGCCAGCAACACCCAAGGGTTTGTTCACCA
ATGCTTATTCCTCCTCGATATATCATCGTGTTAGAAGAGTACTCGTCTTCATCTTCAGGTTGGTGACCTATGGGAGTGTAGCTCTCAACTCCTTTCTATC
TGCGCCAAATGACTCAACGCCGAAACCCTTGACGTAGACATTTGTAAAGAGCTCAGAAGCATCAGGCATAGGACTTTCCTTGGCTTTAGCAATGGCAGCG
TCGACTTCTTTCCTAATTTCTTTCTCCATGTCCTTGAGCTCAGCAGGGGTTGCTAGGTCATGAGCCAAGAGCAACTTTCTAACCCTTTCAATTGGATCAC
GCTCCTGTCTTACACCCGAGATCTCATCCCTGGTGCGGTAAGTGCTTCCTGGATCTGACATAGAGTGGCCGTGGTACCTATACGTGTCCATTTCAAGAAC
AATTGGGCCATTTGCAATGGCATGCTCCTTCGCAAATTTGCATGCCTGCTTCACAGCAAGAACATCCATTCCGTCGACCTTCAATCCAGGCACATAGTCA
CCACGCTTGTAGTAGGAGGGGCTCTTGGCCGCCCTCCACTCAGCCGTTCCCATCCCGTAATGGTTGTTCTCGCAGACGAGTATGGCGGGCAGCTTCCAGA
GGGCCGAGATGTTGAGCGCCTCAAAGAGCTGGCCCTGGTTGGCGGCGCCATCGCCGTAGAGGGAGAAGGAGACGGTGTCCTCCTTCCTGTACTTCTGCGC
GAAGGCGAGGCCGCAGCCGAGGGGCACCTGGGCGCCGACGATCCCGTGGCCGCCGTAGAAGTTGGCGTCCTTCTTGTAAAAATGCATGGATCCGCCCTTG
CCGCGGGAGCAGCCGACCTGGCGGCCCATGAGCTCGGCGAAGGCGGTGACGAGGTCGCCGCCGCGGGAGAGGAAGATGCAGTGGTCGCGGTAGGCGGTGA
TGATGGAGTCCTTGCGGGTGATGGCGGCCTCCATGCCGGCGCAGACGGCCTCCTGGCCGTCGTAGAGGTGGCAGAAGCCGCGGATGAGCTTGGCCTTGTA
GAGCGAGTCGGCGGCGATCTCCATGCGGCGCATGAGGGACATGTCGTGGAAGAAGGCGACGAGCTCGGCGGGGGTGGTGGCGACGTCGCG
page-top