Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17480  (registered. 2003)
Contig Information
Length 829 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit Os07g0160400 [Oryza sativa (japonica cultivar-group)] >gi|113610475|dbj|BAF20853.1| Os07g0160400 [Oryza sativa (japonica cultivar-group)] >gi|218199126|gb|EEC81553.1| hypothetical protein OsI_24977 [Oryza sativa Indica Group]
Score 738
Evalue 2.79277e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17480
TGGCGATGAGGTGCCTCTCTTCTCTCCCTCTCCTCTCCGCATCCGGCTCCGGAAAGGCCTGCGCTGTGGTCAGAGCGCATCACACTCCCTCTGCTGCCGC
GCACCGCCGGATCCGGACTCACATGTCGGTGGCCACCGGCGGTGAGCAGGCCCTGACGGCCAAGGAGCAGTCCCAGGAACCTGACTATGGAGTTGTTAGT
ATGCACCATGTTGGAATACTATGTGAAAATCTTGAAAGGTCGATGGCATTCTACCAGGACCTCCTTGGTCTTAAGGTGAATCCTGCTAGGCCAAATGACA
AGCTTCCGTACAGAGGTGCTTGGCTCTGGGTTGGTTCTGAGATGATCCACTTGATGGAGCTGCCAAATCCAGATCCACTGACAGGACGCCCAGAGCATGG
TGGGCGTGATCGTCATACCTGTATAGCAATCAGAGATGTCTTGAAGTTGAAAGAAATCTTTGACAAAGCTGGAATCAGCTACACGCTCAGCAAATCCGGG
CGACCAGCGATCTTTGCACGAGACCCGGATGGAAACGCGTTGGAATTTACACAAGTGTAACAAGTGAGAGTCAAATTTCCAACTAGAACACACCTCACAG
AATGGTGCTTGTAAGATTACTGTATCCAAGACCTTGTTGCAGGTCTTGCTGTCTAGCAAACAAGATCTGGCTGGGGCAATTCTGCTTGTGCCTTGTACAT
ACCAGTCAAGAAATTGAGATGTATCTATCACATGATGATAAACTGGCATTTAAAATGTTAGCCAATTTGGTCTGTAGTAGTGATTGAGTATTACTGAATG
ACCATGGGTATGGACAAATAAAAAAAAAA
page-top