Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17457  (registered. 2003)
Contig Information
Length 688 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_27213 [Oryza sativa Indica Group]
Score 1005
Evalue 2.16315e-107
Total Hit Count 430
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17457
ACCCCTCGGCCGCCGCCGGCGAAGCGCGCGGGCGAGATGGCGCTCTACCTGCTCTTCGAGTCGGCGTCGGGGTACGCGCTCTTCCACGCCCACGGCATCG
ACGAGATCGGCCAGAGCGTGGACGCCGTCCGCTCCACCGTGCTCGACCTCAAGCGCTTCAGCAAGGCCGTCAAGCTCGCCGGCTTCACCCCCTTCCTCTC
CGCCGTCGACGCCCTCAACCAGTGCAACGCCATCTCCGAAGGGATCATGACCGACGAGCTGAGGAACTTCCTGGAGCTCAACCTGCCCAAGGTCAAGGAG
GGGAAGAAGGCCAAGTTCAGGGTCGGCGTCATGGAGCCCAAGGTCGGCTCCCACATCACCGAGGCCACCGGAATCCCCTGCGAGTCCAACGACTATGTCC
AGGAACTGCTCCGCGCCGTGCGGCTGCACTTCGATCAGTTCATTGACCAACTCAAGCCATCTGACCTGGAGAAGGCCCAGTTGGGTCTGGGGCATAGCTA
TAGCAGGGCAAAGGTCAAGTTCAATGTGAATCGCGTGGATAACATGGTGATTCAAGCCATCTTTCTGTTGGATACACTCGATAAGGATGTCAATTCCTTC
TCCATGAGAGTGAGGGAGTGGTATGGATGGCATTTTCCTGANCTGGTCAAAATTGTGAATGACAACTACCTTTATGCTAANCTTGCCA
page-top