Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17451  (registered. 2003)
Contig Information
Length 755 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 5
Homology (BLAST) Top Hit surface antigen 5, putative [Toxoplasma gondii ME49]
Score 83
Evalue 2.10347
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17451
AAACCAAAAAGTCAAGCAAGAATTTGATAGGGCATCTAAGCCACGATAACATTCAGTCACGTTGGTATGCAGTGTTGGTAGGGCGAAATGTGTCAATGCC
ACGATAACATCCACATGTCCACCGTCATGCCTCCCCGGCTCCTCCTGTCAACCACGCGCCTCTGCCAGCAGACGTAGATTCGGCACTGGCCTCTGCCATG
GCGTGTCCCCACCTTCCTCTTCGCGCCTGTAGGAGAGGCATCGCCTCAACAAACAGTACTACGAATGAACATTGCAATATTTGTTCATAGTAAATAATCC
TTGTACGTCAGAAACCAGAAATTTTGTGTCAGTGTGTTTCGTGAGAAGAGGACGCCAATCCGTCCATCCAGAAATCACAACCCTCCATTACTACTGCCAG
CATCATGCCATTAACTGGTTCTGTAAATCCAGTAGATCATAATCCTTCGTGGCAACAAGGAGGGCCAAACGTTTATGTTCTGGCAGTAGATATCACTACC
ATGACCACTGCCTCAACGACTAACTTCCAGGTTCAGTATTGCAGGTCCTCATATATGCCATCAAGACGATCAGAAGACATATAGCCGTTAGTGATGTTTA
AGACAGCGACCAGAGCTTGTAGAGTTAGTCGTTGGGTTTTGCTTCTCTACCACAGCAGCTCCGTCATGCGCGAGGTTCTTGCACTGGTACTGCTGCCCAT
GCACTCTGCAACTTTGCCTTCGACAATCTACATCGTCCTGAAGTCCCGGTGCTCT
page-top