Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7088  (registered. 2012)
Contig Information
Length 1441 bp
Clones alternative view 157 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 2
Wh_r Root 8
Wh_CSEC Callus 3
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 5
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 10
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 9
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 11
WH_XT Roots, 18 day old plants were grown hydroponically 11
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 12
WH_SP 2
WH_XA Root 6
WH_XB Root 12
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|19880505|gb|AAM00368.1|AF366564_1|AF366564_1 aquaporin PIP1 [Triticum aestivum]
Score 593
Evalue 2.00E-167
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7088
TGTTTGACATGGGTCCTCCAGTAAGCAGGGAAGTTCAGCTGATTTCTCCCCAATATCCTTTGGACCACACACACATCATCTCCTCCACCTCTCTCAACCA
AGCCAAGGCCAAGAGCTGAGTGAAGCACCCGCGGCCATGGAGGGCAAGGAGGAGGACGTGCGGCTGGGCGCGAACCGCTACTCGGAGCACCAGCCCATCG
GCACGGCGGCGCAGGGCGGCGGCGCGGACGAGAAGGACTACAAGGAGCCGCCCCCGGCCCCCTTCTTCGAGGCCGGGGAGCTCACCTCCTGGTCCTTCTA
CCGGGCCGGCATCGCCGAGTTCCTGGCCACCTTCCTCTTCCTCTACATCTCGGTGCTCACCGTGATGGGCGTGGTGGGCAACCCGTCGGGGTCCAAGTGC
GGCACGGTCGGCATCCAGGGCATCGCCTGGAGCTTCGGCGGCATGATCTTCGTGCTCGTCTACTGCACCGCCGGCATCTCCGGCGGCCACATCAACCCCG
CGGTCACCTTCGGGCTGTTCCTGGCCAGGAAGCTGTCGCTCACCAGGGCGGTGTTCTACATCGTGATGCAGTGCCTGGGGGCCATATGCGGCGCTGGGGT
TGTCAAGGGGTTCCAGACCACGCTGTACCAGGGCAACGGCGGCGGCGCCAACTCCGTCGCGCCGGGGTACACCAAGGGGGACGGGCTTGGGGCTGAGATT
GTTGGGACGTTCGTGCTGGTGTACACCGTCTTCTCCGCCACCGACGCCAAGCGCAGCGCCAGAGACTCCCACGTCCCCATTTTGGCGCCGCTTCCGATCG
GGTTCGCGGTGTTCCTGGTGCACCTGGCCACGATCCCCATCACGGGCACCGGCATCAACCCGGCGAGGTCCCTGGGCGCCGCCATCATCTACAACAAGAA
GCAGGCGTGGGACGACCACTGGATCTTCTGGGTGGGTCCGTTCATCGGCGCGGCGCTGGCGGCCATCTACCACGTGGTTGTGATCAGGGCCATCCCCTTC
AAGAGCCGCGACTAGTCCACCAATCAACCAGCTGCATGCGGATGGAATCTTATCGCTGTTCATCGTCGGTCGATCGATCATGTGGTGGTGGTGGTTGCTC
GCGCGCGCGTAGGACGTGGATCATGTCTCGGCCGCGCACGCTGTGATCATCTATATCTACCGTGCTGTTCCTCCTCTCCTCGGTGTGTGTGCCTGTCGGC
AGCGTCACCTGTTCAAGTCTGCGAGTTTCAGTACTCCCTGTTGTACTTTCCCTTCCTTTTGTATTGCACGCGGTTTAATGGAGCGTGCATATGTATGTAA
ATTACTATTATGAAGGAACGACGATCGAGTTAATTAACGATCTTCTCGCCTGGAGATGAGAATAATATATATAAACATTATGTGATCATCGTCCTATTTT
CCTCTTCGATCGGACGTGTGTCGTGCTTATCAAAAAAAAAA
page-top