Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17393  (registered. 2003)
Contig Information
Length 903 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsI_14197 [Oryza sativa Indica Group]
Score 956
Evalue 1.711e-101
Total Hit Count 176
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17393
TTTTTTTTTTGTACAATCAATTTATTATTGACGGTATATAAAATTTATATCAGCGCAAAGATTCTGCAATTTTTTAATACAACGGAACTTTTTCACACAA
TTACATGTTTGTTTGATCTAACCACCACACTAAAACTCTCAACAGTAACACACCTAACCTTATTCTGGCCCGGACCCCTCACATGGCTCCGCGCTCTAAC
AGCTCCCATCTGAAATTCGGTGCAGCATAAACCTTGGGGAGGGTATGGAGGAGTATTCCGACGCAAACGCAGATCACGGCGACACCCATCACAGTGAACA
TTGCTGGCCTGTACAGGAAGGTCCTGGCTAAGGAATTGGGGTACATCTTACCCTGACAACTGCAGATGTTGCACCTTGCGGCGGATGTTGTTGTCATTGG
CATGGCTTTGCAGATCTCAAGGCTGATATCACCTGCCTTCATCCCATCGGTTATTCCAGGGCACATGCTGCTAGGAACGCCGAGGACAACATGACCTTTG
CCAAGATGCTTGTCAATCTTCTTCTGGACAAGATTGATGTAAGCATCGTTGCCACTTTGGCGAGCGTAATCTTCAGGGGTAAAGCCTATCTCGTCTCTCG
CATTTCTCCATGCATTGAGTCCCACCAGTCCAGGGTCATCAGTCAATGCATCCAATACATCCTCTGCATCACTAGTAGCGGCTGCTATATGGAGGGGCGT
AAATGCAGAAGGGCCCTGAGCATCAGGTCTGAATAGGTATGTCTCTGCAGTTTCCTTCAGGTTTTTGTTCGGCTTGTATGTCAGCAGAAATCTAACCATT
CGGGCAGATTTTCCTCGCACAGCAGAGTGTAGCAAATTTTCTGACAATACCACATCTTTGGGAGACTGCAACCCAGCATCAACAAATCCATCAAATAACA
AAT
page-top