Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17381  (registered. 2003)
Contig Information
Length 1395 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit pre-mRNA cleavage complex II protein Clp1 [Zea mays]
Score 1593
Evalue 4.4689e-175
Total Hit Count 434
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17381
ACACGTCCGACGAGACGCCGATGGTGATTTATGTGAACACACATGCGATTCTTGATGCACGGAGGGCGAGGGCGAGGGCAGCGCAGGGAGGCGACTTGGA
GGCCTCACAGGGACCTAGAGTGATTGTTGTGGGGCCAACTGATTCTGGAAAAAGCACTCTGTGCAAAATGCTCCTTAGCTGGGCTGCCAAACTGGGATGG
AAGCCTACATATGTGGATTTAGATATTGGCCAGGGTTCGATAACCATACCTGGATGTATTTCTGCTACACCAATTGAGAAGCCTATCGATATAGTTGATG
GGATTCCTTTGGAGATGCCGCTTGCATACTTTTATGGCCATCCAAATCCAAGTATTAATCCAGATGTTTACAAAGCGCTTATGAGAGAGCTAGCTCAAAC
ATTAGAGACACAGTTCTCGGGGAATGCTGAATCTAGGGCTGCGGGTATGGTTATCAACACGATGGGATGGGTTGAAGGCCTTGGCTACGAGTTACTTCTT
AATGCGATTGAAATCTTCAAGGCTAATGTAGTGCTGGTACTGGGACAGGAGAAGCTCTGGAAGATGTTAAAAGATGCAGTACAAAGTAAGCCCAATATCG
ATGTCGTAAAACTTCATAAATCTGAGGGTGTTGTCCTAAGGAATTCAAAATATCGTCAAAAGACTAGGAGCTTTCGTATCAAGGAGTACTTTTATGGGAT
TGCAAACGATCTGGCACCACATTCAAATGTAGTCAACTTTAGTGATGTTTCTGTTTTCAGAATTGGTAGTGGACATCAAGCTCCACGGTCAGCTTTACCA
ATTGGTGCAGAGCCTGTGGCAGATCCCACTCGGCTTGTTGCTGTCAACATCAGCACTGATATGGTCCACACAGTGCTTGCTGTTTCTTATGCGAAGGAAC
CTGATGAAATAATTTCGAGCAACGTTGCCGGATTCATCCATGTCACAGATGTTGACATCCAAAGGAAGAAGCTGACGTACATCGCGCCTTGCCCAGGAGA
CCTGCCAAGCAGGCTGTTAATCGCGAGCTCCCTGACATGGTACGAGCAGGCTTGACCCGGTTCGAGGTTGGACATTGTAGGTAGGTAACCAGATGGCTGA
TGACATGTTGTAACGCCGAAATGGATACTCTGTGCATTTGATAACTGGAACACTGCTGGTAAAGCTGAAAAGCTGAATGGGTTGGACGATATCTCAGGCA
TCTTGCTGCGAAGCTTTCTGCTGACTTGCTTATGCTTTCTATGCTGCTGTGGCGGCGAAGATACAAATAGTTAGGTCAATGAAAGATTGGTGTGCTCTTT
TGTACGCTGTTGGGAACTAAGATATACTAGAAGACGAGTCCCTTTGGCCTCTTCTCAAAAAAAAAAAAAAAAAACCCCANNTTTTTTTTTTTTTT
page-top