Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17347  (registered. 2003)
Contig Information
Length 1523 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_SHDr Shoot grown with dessication 4
Homology (BLAST) Top Hit hypothetical protein OsI_22945 [Oryza sativa Indica Group]
Score 1909
Evalue 0
Total Hit Count 324
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17347
TATCTCATTGATGGGCATCCTGGTAATGCATGACCGCCTGGACCAACGAGACGGCATGCCACGTCACACACCCTATAGTTTCGTCGGTATCTTTTATTAT
ATGTTCAAACGCACAAGGCACCTTCAGTAACAATTTACATGGTGACAACAGCCTGACGAACGCCGGGCGCGCTTCATCCGCCCACCTGGTAAAGCCACCG
AACCTCATTTCAGAGACATGCGTTTGTACTCCCTCATGGTGTTTGTGATGGCCTGCTCAACCGGCAGCCTCTCCATGCTCGAGGCGCCGTAGAATCCATG
GACCCGGTTCGTGTTCTTCAGGACAAACTCCGCCTCTCGGGGCCCTGATATGGGACCTCCATGGCAGAGAACGATGATGTCAGGGTTGACGCCGACCGCG
GCATCGGCAATGGCTTGAACCCGGACAATGCTGTCATCTAATGTGGCGGCCGTCTTTGCGCCGATCGATCCAGCTGTTGTGAGGCCCATATGCGCGACTA
CAATGTGCGCTCCGGCCTTGGCCATGGCAGCGCCTTCTTCTGGATTGAAAGCATACGGGGTCGTCAGGAAACCCATGCTGTGAGCCCTTGAGATCATCTC
CACTTCCATGCTGTAGCCCATTCCAGTTTCTTCCAAGTTCTGTCTGAAGTTCCCATCAAACAGACCAACCGTAGGAAAATTTTGGACACCACAAAATCCA
ATGGCTTCTAGCTGTTTAAGAAAGTAATCCATTCTACGAAATGGATCAGTAGCGCAAACCCCAGCAAGAACAGGAACTTCTTTAACGACAGGCAACACTT
CATTGGCCATCTCAAGTACAATTGCATTTGCGTCAGCAAATGGTAGGAGCCCTGCTAATGAGCCCCTTCCAGCCATACGAAACCTCCCGGAATTGTACAA
CACAATCAGATCAACCCCACCAGCTTCTTCGAACTTCGCGGATATGCCCGTACCAGCACCGGCTCCAATTACAGGAATACCCTCACCGATTTGTTGCTTT
AACTTATGTAGTATTGACTTTGTTTTTTGCAAAGTTTCTGGTCTTGCATCAGGGAAATCCACTGGGGGTCTCCATATGATAGAACTATCTGAAGTCTTCT
GTCCTGAAGAAGATTCCTTTTCATTTGTGTCTTGCTTTGGTAGGACCATGTTGTTTTTCTGAGTTATGGCACTAGAGGCCTTTATATCCATACTCAAGAA
TGCATCCACCAAGGCATTGGCAAATTCAGGATCGTTTATATGATAAGGAAGCAGCTTCAGCTGTCTGTTCTCAGTTTTGACAAGACGAGTATTTAACTCA
TCCAATAGTGCAGATGTAGCCTCAGGATCATAAAACGGCATTCCAGGTGCATCTATTGCAGAGATGCCCTTCTGTGGAAGGCAAACAGTAACTGTAGATA
AAGATTTGTTCAGCTTGTCAGCAATAAACTGAGCAAATTTCTTGTTCTCCTCCACGGTCGTCCGCATCAACGAAATCTGTTCATTATGTATGTGGATCTT
TCTGTCTGAGAAAGCAGCAGGTA
page-top