Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17296  (registered. 2003)
Contig Information
Length 555 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit postsynaptic protein CRIPT [Zea mays] >gi|195628180|gb|ACG35920.1| postsynaptic protein CRIPT [Zea mays] >gi|195638164|gb|ACG38550.1| postsynaptic protein CRIPT [Zea mays]
Score 508
Evalue 5.48735e-50
Total Hit Count 105
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17296
TTTTTTTTTTGTGCCAGGGCAGCAAAAATCCACATTGCTCAAGGGTGCAAATTACAGAGACAACCACGCCCGGTTTACACAACTGTTAAAAATTGCTCTT
TTCATAACACGCACACAACACCTTTTTCCACAGCAATATCGCTAGTACATGATGTCATGATCTTACATGTTAAACATACCAAGTCCACCACTTGAGTATC
CTGCTCACACATTGCTTTGCTTGTACAGCTTCGTGTCCAGCACTTGCTTGCCACACATCGCACACACCCCTTTTGAATAGGCACAGGTGTGGCAGTATTT
ACCGTCCTGGTGCACCTGTTGCTTGCAGATTATGCATTTGGTATTTCCGTAAGGAGTCCACCTGCTCTTCTTGGAGAGGAGCTTGTTCTCGTTGATCTTG
CGGCCGCCGCCCTCGTAGGTGTTGCTGGCGCCCTCCTTCCACTTGTCCGGGACGATCACCTTCCCCAGCTTCTTCTCGCACTTGGTGCACACCATCGCCG
CCGCCGCCGCCGCCGCCGGTGATCGGGTTTTTTTTTTCTTGAGATGCTGGTGATG
page-top