Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17290  (registered. 2003)
Contig Information
Length 1156 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit hypothetical protein OsJ_018132 [Oryza sativa (japonica cultivar-group)]
Score 1203
Evalue 5.75526e-130
Total Hit Count 324
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17290
TTTTTTTTTTGTTATAGCACATGAAGTTTTAAAATTAACATTGGAAGTCACCCATAAAACAGTCACAATGATAAACTGAAGGAGTGATTGGAACCAAAAT
GGGACCCTAATTTTGTTACAAAATAATCACCTTACTAGTTGACATACACACACCTACAATCATAATCATGTACACCATTTGTCAAACCCCATAGTTTCTT
CATGGAGGACAAAATACAAATGATACAACACTACAAGGTTGAGGTAAGAATATCACCATTACTGAGGAACAGATATTCACCAAGATCCCTGCCAGCAACT
TAACAAATCTCAGAGAAAAATAGATTATCACCGGAACCACAAGGTACTGATCAACTGATCACTTTGCTGCTCCTTCAAACAAGTGCTGGATATGTGCCTC
GACATCTTCTGGGGTGTACTTGATGTACAAGTCACGTCCAGTTTCAGGAGCTGATTTTAACCTGGCAATCAAAGCCGCATATGCTGGCATCACTGAATCC
TCCACTGCTGCCCTAACGTCCATTCGCAACTGATCATCGGCTATCACCCATTCTGATTGTACTGCGTAGATCTCCTCGAAGTAGGTATTAAACATCCGCA
ATTTCTGCAGCATTGCCTTGGCTGGGAGTGCACCAACGCCTGAACCACCAATCTGCAGCACAGTTGTAACCTTGCCCCATGTTGAACGCTGATAATCCAT
GCTCCAGCGACGCACTCTAGTTGACAACTGCTTGATCCAGTCATCGCCGAGTAGAACACCTAGCTCGCTGTCATTCACTTTCTGGATAATGTACTTGCCA
TTGTTCATCAAGAAGATGCAAGCCAGTGACGGATCTCGGTAAATCTTAGATTTTGTATCCAAATTCTTGTGCAGAACGTCCATGATCCATGCGATGTGCA
CAGCAAGTGAAGACGTGGGGCGGTCAGGGTCCACGGCAGCAGAAGCTCTACCACCAGCACCAAGGTCACCTTCCATCACCTCTTCCAATGTCTGTCGCGA
ACCGCATGCAGCACGGAGATAGTTCATGACATACCGAGTGATGGGGTGTATACCACCACCAGGTGTGGCAACCCGGGCAGGGTCACGGCGGATGAGATTT
TCCAACTCCATGAATATACCTTTTATTGAGGAACCAAGGGTGTTGCACACTGCAGA
page-top