Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17289  (registered. 2003)
Contig Information
Length 1197 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os09g0323500 [Oryza sativa (japonica cultivar-group)] >gi|48716989|dbj|BAD23681.1| unknown protein<similar to Oryza sativa chromosome 4, OSJNBa0017B10.5 [Oryza sativa Japonica Group] >gi|113631104|dbj|BAF24785.1| Os09g0323500 [Oryza sativa (japonica cultivar-group)] >gi|125563232|gb|EAZ08612.1| hypothetical protein OsI_30883 [Oryza sativa Indica Group] >gi|125605212|gb|EAZ44248.1| hypothetical protein OsJ_027731 [Oryza sativa (japonica cultivar-group)] >gi|215701238|dbj|BAG92662.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1336
Evalue 2.29099e-145
Total Hit Count 330
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17289
GGCCTTAGTATACATTTAATAAACATCAGAGTCGATATCTACTGTATTGAAGAACTGAAGGTACAATGTCTGTAAAGGATGTATGATCATAGACAGAGGT
GGCAACATGAAGTCTGTAAATACACATATTATATCATATTATTATTATGTATATATATTCAACAAATTTGACTTGATCTGTCTCTGAATTGATAGATCCG
CATACAGTAAATAATTTAATCGCCATAATTAGAGATCATTATGTGATCTTAAAGCACAACTGTGGAAATAACAGCATGCACAATGGTAGCTATTCATTCT
TTCTTCCTATTTGAGGCTCCCGCCTTTAGGTGCGCATTGGCAATTCTATCTGGTAATTCACTGTGTGGTTCTTCCATATACCACTCTCGAGGTACTTCTC
ATATAAGCTAGCTTCTCCATCATAGTTCACTGAAAGAACTGCTGTGCTCCTTGTCCCATAGAGCCCTTCGTCAGTTTGCACCTCGATGAAGATGGAGCTC
AGACCGTGCTCCCAGTTGGGATCACAACCGGTGTTTGGCAGCCTATCTTTATCGGCCCTCGTCGTGTCAGTCATTAGTCTGTCAGCTATATCCTTCGCTT
CAACTTCATCATCACCATGCTTCCTTATAAACTCCCTGAAGTTTTTACCAAGGCGAATTGCCTTCTGCCAAGGGCTGTCTAGCCTTGCATTGGACAACAC
ATGGAGTCCTGGTGAGACGAGCTGAATCGTCGCAGGCTGCCCCTTTGGCCGGTTTGACACATAAACCATGACATTCCTGGTTAGATCAGCTAGTATAAGG
TTGAAGCCATTGTACTCATCAGCTTCTTTTGCCACTTCAGTTGCAACCTCCAGCGGGCTCTTGTTGCCCTGCAGGAACCTGAGGGGCAGGTCTCCCCTAG
TGCGTGCGCCAGGCATCGCATCAGGCTCGAGCACATTGGTCAGGAAGGCAAGTCTGCCATCCTTGGTGCTCCCCATCCATGTTCCTCCACCAAGTACATC
CCTGCCGCCAAGAATCTTCATTGAGCCCTCCCCCCACCATCCTACTGCCTTTGTAGGCCTGCTATGGAACTCATCTCTGTTGAGCAGAAGCAGGAGCTGA
TGCTGTGGGTGAGCCTGCCAAATCCATGCAGCGATACACATGGCTTCAGGTGTTCCTTCCTGCTTCTAAATAATTCCCTTGTTTCGCAACCGTGCGC
page-top