Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7066  (registered. 2012)
Contig Information
Length 1081 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242347655|gb|ACS92632.1|| putative PEX11-1 protein [Triticum aestivum]
Score 463
Evalue 1.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7066
TTTTTTTTTTACTTAATTTTTTTTTTTGGTTCGCAAGTGCCAACACTGTTGGCCTACATAAGCACCATGCACGAACACATGATCGACCATACATACCATG
TCCATTAGTACTGTTCATAGCATACCGTGTACATGTATATGTATGAAAACCGTACGTACAGATGATCGACATCATCATTCTATACTGCTACGTACACAGG
AATAAAGCATCTCGGATTCCATGCTCGAGCACAGCACCGACTCCAATTAAGTGGAGGCGGACTGTGGAGCAGAGCGGTGTAGCGTTCCTCGCGATTGCTC
ACGCCTTGAGTTTGGCCAGGGGAGCCCGAGACGGGAGTTGCTGGTAGCAGGAGATGAGGGAGGTGACGAAGCCGAAGGCCCCGGTGACCCTGGGGGTGAC
CTTCTTGGGCGCCAGCTGCAGCAGCCCCACGGCCACCACCACGTCCATCCCCGCCTTCACCAGCGCCAGCAGCCGGTCGTCCGACTGCTTCATCTTCCCC
AGGTACTGCTCGTCCTCGTATTTGTCGGCGCCCCTGAGCTCCTTGGCGCGCTTCCTCATCGCCTTCGATAGCCTCTTGAGCTCCCCAAGCTCGACTAGGC
TTGCACAGACAGAGGAGGCCATCCAGCAGTAGAGGGATATCCTGGCGATGCGGTCCGTGCGCTCCTTGTTCTGGTATATCCCTGATCTTCCTATCCACAC
GAACTGGTCCAGGAACAGGAAGGTCGACAGCAGCGCATTCTTAGACTTCCCAAGCAAGACGAGTGTGAGAGGGGTCCCTTTGGGGGCTGGGCTGATGAGA
GCATGCAGATCGTTCACCCACTTGAGGAGGCGGAAGACCTTGCGAGCCAAGGTGGTGGACTTGTCGACGTTCTGCGCGGTGCCGGGCTGGCCGTTGCTGA
TGAACTTGGAGCCGTACTGGATGGCCCTGCAGATCTTGTCCCGAGCCTCCGCCTTGTTCAGGTACAGCACCGCCAGCCCCAGCTCCGCCCGCGTCGCCTC
CAACGAGCACATCTTCCTTCCTTGCTAATGACGGAGCGGGGCGAGGGCAGGAGGATGGAGAAGGGGCCGGCCGGCTGGTGC
page-top