Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig17142  (registered. 2003)
Contig Information
Length 1100 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1290
Evalue 4.37729e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig17142
GTACTGATATCATGACAACACAACAGCTAGTATTCAGTATTTACAGTGTACACATGTGAAAGACAACAAAGAAACCAGCATTGCTCCGCGGCGTTCCCAA
ATTTGCACCGATGATAAGCAACTGAAACTGCTTGCTGAAGATATCAGGTTTATTAGTAACTGGCTGAACTAAGACACATAGAGCGGTTCAGGCGCAGTTT
TCCTCTGTATCCAGTTGTCCTTGGACCATTTACATCCTTCCATGTCAACTACATGTAAGCTCAGTGCATGTCTTGACACTGGAGAAAGGTTCTCAAAGCT
CTGATGTACAAGATCGCCGTGAATAACAACAAAGTCACCTGATTTCATTTCCAGTGGTACAAACTCTTTCTGGTCATAAAGCGGGGAGGGGCGATCAAAA
TGAGTACCATTTTCATCTCTGATCATTCGCCTTTTTAGACCATTTTTATGTGATCCGGGAATTGCCCATAGGCAACCGTTTGTAATTGTTGCATCTTCAA
GTGCTAGCCACAATCCTGTGCATGATAGGGGCTCTGTATAAAGGAATGTATTATCCTGGTGTGGCACCACCTCGCCACCAATGCCCGGTTGCTTAAAGAT
GTACATAGATTGAATAACTGCAGGTCTCTTGTACCCTAAAGAAGAGAACAGGCTAGAAATACTCTCCGAGAAAGCAAACTTTTTGAACACAGGGTCATGT
TCATGTAGTGCATGTCCAACTTTATTGATTGAAAGTTCCTTTGGCTGTCTCAAGCATCCATCATCTCCAAATGCCTTTTCCTCGAAGAAGAAAGATATAT
TCTCCGCACTCTTAAAGAAGTAGTCATCCTTCAACTGCCGATGATCCTTAGTGGAGAAGACACTGGAGTCAGCGCCGTCGAAGCCGTGGACGAGCTCGGC
CATGCGGCCCCGCATAGCCTGAACCTCCTCCGCGCTCGAGAACGACTCCAGCACCAGGTAGCCGTTCTTCTCGAAGAAGCTGAGCTGCTCGGCGGTGAGG
CTGCCGGCCGGCGGCATGGCGGCGGCGGAGGAGGTAGATGTATGAACGGAACAGGGGATGGGGATTGACCAGTGGAGGGGATGGGTACGGAACTGTTGCC
page-top