Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7056  (registered. 2012)
Contig Information
Length 1283 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20161472|dbj|BAB90396.1|| ADP-ribosylation factor [Oryza sativa Japonica Group]
Score 370
Evalue 2.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7056
GGCACCACCACAAGGACCAGGCGCCGGCGGCGTCGGGCCCCAACCAGATCTTCAAGATCTACTGCCGGGCCTCGGAGGACTACTGCCTCGCCGTCCGCGA
CGGCGAGGTGGTGCTCGCCCCCGTCAACCCCAAGGACGAGACCCAGCACTGGCTCAAGGACATGCGCTTCAGCACCACCGTCAAGGACGAGGAGGGCATG
CCGGCCTTCGCGCTCGTCAACAAGGCCGGTGGCCTTGCCTCGTGCCGAATTCGGCACGAGGTTTCTCTCCTCCTCCTCCTGCCACCGATCCCGAACCAGG
GAGGAACCCGGCGCGAGGAGGGCAAAGGAAGAGAAGAGGAGATCACCGAGCCCAGCGCGCGCACAGGACAGCAGGCGCCGCGATCTCGGAGCGGAGATGG
GGCTCACGTTCACGAAGCTGTTCAGCCGGCTCTTCGCCAAGAAGGAGATGAGGATCCTCATGGTCGGTCTCGATGCGGCTGGTAAGACCACCATCCTCTA
CAAGCTCAAGCTCGGAGAGATCGTCACCACCATCCCCACAATCGGGTTTAATGTCGAAACTGTAGAGTACAAGAACATTAGTTTCACCGTTTGGGATGTC
GGGGGTCAGGACAAGATCAGGCCCCTGTGGAGGCACTACTTCCAGAACACCCAGGGTCTCATTTTTGTCGTGGACAGCAATGACAGAGAGCGTGTTGTTG
AGGCAAGAGATGAGCTTCACCGGATGCTGAATGAGGATGAGCTGCGTGATGCTGTGCTGCTGGTGTTTGCCAACAAGCAAGATCTTCCTAATGCCATGAA
CGCTGCTGAAATCACTGACAAGCTTGGCCTGCATTCTCTGCGCCAGCGACACTGGTACATCCAGAGCACATGTGCTACCTCTGGAGAGGGGTTGTACGAG
GGCCTTGACTGGCTGTCCAACAACATTGCCAACAAGGCTTGAAGCATCTCGGCAGGGGCTTCTATGGATCTGGATAAGCTGGATATTCGGACTAATACTG
CCTTTACGTATTATAAACTATATAGTCTTGACAGATAATGTGGGTGTTTTGGAAAGATAAAGCTCTCTGTCAAAGAGCTAGCTATCAGATTGTTTTCGTG
GGTGTTAAATTGTCCGTGGCGCTGTTTGTTTGCCCATCATGGTTTTACTATGTCCGCTTTGTACTCTGTACTCGCCACTCCGACAGACTTGATACATTGT
AGTATTGACTTGTCTTGGCATAGTTTGTCAGCGTGTCTTCTGAAAAAAAATCTCTTGTGTTGATTTCATGTGCAAAAAAAAAA
page-top